Who makes up the president’s cabinet? (1 point)
chiefs of staff
directors of agencies
secretaries of departments
senior military officials

Answers

Answer 1

Secretaries of departments.

Answer 2
Secretaries o departments

Related Questions

PLEASE HELP, IT’S URGENT!!
( I’ll mark you brainliest )
Medieval Guilds Reflection

1- Explain what modern-day profession or craft should form a guild of their own. Describe what that guild would do:
-What would they protect guild members from?
- What professional rules would they set for guild members to follow?
- What would an apprentice have to do to earn "Master' status in the guild?
-What else might the guild do for members that I haven't thought of here?

2- Guilds set prices for their work and the goods they traded. Obviously this was good for guild members, but do you think it was good or bad for people who had to buy things from the guilds? Explain why you think so.

Answers

Answer:

The guild helps you make money but when you first start out make sure you pick Arabis! Their specialty is horse man and knights. So at first make sure to research horse man and knights. Admiral and ocean works good too. The guild doesnt even matter i never research it. Nice to see another Hexonia player!

Explanation:

depression definition economics​

Answers

Answer:

A depression is characterized as a dramatic downturn in economic activity in conjunction with a sharp fall in growth, employment, and production.

What lessons about slavery, racism, and freedom does the slave narratives of Frederick Douglass and Harriet Ann Jacobs offer?

Answers

Answer:

Slave narratives served an ideological purpose, namely to elicit the sympathy of northern readers to the plight of southern slaves as well as to publicize the abolitionist movement

Explanation:

Which projects were introduced by roosevelt to try revive the situation

Answers

Explanation:

They provided support for farmers, the unemployed, youth and the elderly. The New Deal included new constraints and safeguards on the banking industry and efforts to re-inflate the economy after prices had fallen sharply.

I’m assuming this is talking about the New Deal programs during the Great Depression. Roosevelt’s New Deal was designed to bring the United States out of the Depression and help the American people recover. There were three main focuses of New Deal programs; relief, recovery and reform. The New Deal programs were designed to offer relief to the poor, recover the economy through job creation and federal spending, and the creation of a social welfare program to avoid another crisis.

The social security administration was made in 1935 to provide financial protection for American citizens. It’s designed to help the elderly, unemployed and disadvantaged.

The Public Works Administration (PWA) created many new jobs for construction workers and also helped to break down racial barriers by having non segregated work crews and hiring people no matter the race. Money was given for the construction of schools, roads, and government buildings.

The FDIC and the SEC were designed to help protect investors and depositors and to help keep stability and confidence in the American financial system.

A Civic Duty includes obligations (things you MUST do) as required by a LAW.
If you do not do them, you will be punished (such as going to jail for not paying
your taxes).
O True
O False

Answers

Answer:

false

Explanation:

I'm saying false because not all the people in Kenya pay tax.maybe you don't have money to pay tax so being jailed for not paying tax, that's not good so things you must do which are required by the law example paying tax yet you don't have money.I think being taken to jail because of not paying tax this is improper.

Hey, can someone please help me out with this?
I’m pretty sure the answer is A but I’m not to sure.

What is the main way that the Shinto religion is different from the other religions?

Answers

The correct answer is A. It has no a sacred text.

Explanation

Shinto is a Japanese religion that worships nature spirits also known as kamis. It is the second most practiced religion in that country after Buddhism. This religion differs from other world religions that have a sacred book such as the Bible (Christianity), the Torah (Judaism), the Pali Canon (Buddhism), the Koran (Islam), among others. So the correct answer is A. It has no a sacred text.

15. Nation-building began in Europe as a result of war and the
a.
growth of cities
C.
end of Muslim rule
b.
Black Death
d.
Magna Carta

Answers

Answer:

a.

growth of cities

Explanation:

Please help!! (no links)

what did the 13th amendment accomplish?

A ) All former slaves are citizens and are equal in the eyes of the law.
B ) All male citizens have the right to vote.
C ) That a state can segregate the population based on skin color.
D ) That slavery is illegal in the United States and its territories.

Answers

The 13th amendment abolished slavery within the U.S or any place subject to their jurisdiction
The answer is D. Correct me if i’m wrong.

In the early 1900s, the Bolsheviks of Russia worked to
• support the provisional government.
O return the tsar to his position as ruler.
O bring about an end to communist rule.

bring about a new socialist government.

Answers

Answer:

The answer is:

D: bring about a new socialist government

In the early 1900s, the Bolsheviks of Russia worked to bring about a new socialist government.

What do you mean by socialist government?

Socialism is a political and economic framework based on common ownership of productive assets. In a socialist system, the government makes all legal production and distribution decisions.

Socialism is a political theory and movement that encompasses a wide range of economic and social systems that are distinguished by social ownership of the means of production rather than private ownership.

In Russia, high inflation and food shortages aided the revolution. Militarily, insufficient supplies, logistics, and armament resulted in devastating casualties for the Russians during World War I, further eroding Russia's opinion of Nicholas II.

Therefore, the correct option is D.

To know more about the socialist government, visit:

https://brainly.com/question/23735589

#SPJ5

Somebody please help it’s due in 10 minutes I will give brainliest
What country imperialized this Third World Country?

Answers

Answer:

Because many Third World countries were economically poor and non-industrialized, it became a stereotype to refer to developing countries as "third world countries", yet the "Third World" term is also often taken to include newly industrialized countries like Brazil, China, and India now more commonly referred to as ...

Explanation:

I need 5 Brainliest before I can become expert

Cuba was done by US

Nigeria + South Africa by Great Britain

Vietnam + Cambodia is France

Chile by Peru

Guatemala by Spain

why was the 1848 revolt in prussia successful only in the short term?

Answers

Answer:

Answer Expert Verified

The new elected assembly was dissolved a year later and this was the reason why the 1848 revolt in Prussia was successful only in the short term. The correct option among all the options that are given in the question is the last option or the fourth option

Explanation:

Hope it helps! Correct me if I am wrong!

I'm sure about my answer!

If you dont mind can you please mark me as brainlest?

Ita ok if you don't want to!

briefly explain one historical development that encourage the involvement of the United States in the UN after World War II

Answers

Answer:

The impetus to establish the United Nations stemmed in large part from the inability of its predecessor, the League of Nations, to prevent the outbreak of the Second World War. ... After nearly four years of planning, the international community finally established the United Nations in the spring of 1945.

Explanation:

I want an answer! NO links pls!

Answers

Answer:

a

Explanation:

What labor issues occurred in the late 1940s?

Answers

i think that would be cargo

who started the free-soil party

Answers

After the Whig Party and the Democratic Party nominated presidential candidates who were unwilling to rule out the extension of slavery into the Mexican Cession, anti-slavery Democrats and Whigs joined with members of the abolitionist Liberty Party to form the new Free Soil Party.

PLEASE HELP, BRAINLEST AND 6 POINTS !!!!!!​

Answers

Answer: D. Supporting the early payment of money promised to veterans.

Explanation:

The Bonus army was a group of demonstrators who were veterans of the U.S. army from the first World War. They protested in 1932 to demand that their service certificates be redeemed that year instead of 1945 as scheduled.

This demand came about in light of the Great Depression (situation in picture) which caused a lot of hardships as people lost jobs. The veterans and their families wanted therefore, to get paid so that they may survive the hardships of the Depression.

Why do you think the League of Nations refused to use force against Japan, Italy, and Germany?
(in a short paragraph)

Answers

Answer: I am writing this answer under the idea that this is before the official start of WW2 (so without further ado) : i would like to say this is because they did not want to risk another war considering the world was still recovering from WW1. That is the reason why they did not declare war on the axis powers until the invasion of czechoslovakia.

Explanation:

hope this helps you lad :)

have a great day and stay safe :D

Place these events in order by determining whether they occurred first, second, or third.
Event
1.Spanish colonists resettle in Havana
2.Acadians expelled
3.French surrender Canada

Answers

Answer:

3

Explanation:

Sana po tama ang sagut plss heart back

Answer:

Explanation:

1. Spanish colonists settled in Havana in 1514

2. Acadians were expelled by the British in August 1755

3. The French surrendered Canada to the British in September 1759

HELP ITS DUE IN A FEW MINUTES PLEASE HELP.WILL MARK BRAINLEST AND POINTS ​

Answers

A because all the other answers dont fit what the poem is trying to say

Answer:A

Explanation:I mean sorry wrong key

Need help ASAP Cuban Missile Crisis

Answers

Answer:

I only know Question 1 sorry. For Question 1 for Document A, the answer is: The deal Khrushchev proposes to Kennedy is that if they remove their missiles from Turkey, they'll remove theirs from Cuba. If this deal never happened, ww3 would've already started since Kennedy placed troops in Florida getting ready to invade Cuba.

Explanation:

this new position replaced the general secretary of the party as the top official in the soviet union

Answers

Answer:

The President of the Soviet Union

Explanation:

The President of the Soviet Union is the new position that replaced the general secretary of the party as the top official in the soviet union.

This position was created in 1990 after it was realized that the general secretary position lacks definite or clear means of appointing a successor.

Many other Americans have followed Carnegie’s lead and done the same thing, for example

Answers

Answer:

As discussed previously, new processes in steel refining, along with inventions in the fields of communications and electricity, transformed the business landscape of the nineteenth century. The exploitation of these new technologies provided opportunities for tremendous growth, and business entrepreneurs with financial backing and the right mix of business acumen and ambition could make their fortunes. Some of these new millionaires were known in their day as robber barons, a negative term that connoted the belief that they exploited workers and bent laws to succeed. Regardless of how they were perceived, these businessmen and the companies they created revolutionized American industry.

RAILROADS AND ROBBER BARONS

Earlier in the nineteenth century, the first transcontinental railroad and subsequent spur lines paved the way for rapid and explosive railway growth, as well as stimulated growth in the iron, wood, coal, and other related industries. The railroad industry quickly became the nation’s first “big business.” A powerful, inexpensive, and consistent form of transportation, railroads accelerated the development of virtually every other industry in the country. By 1890, railroad lines covered nearly every corner of the United States, bringing raw materials to industrial factories and finished goods to consumer markets. The amount of track grew from 35,000 miles at the end of the Civil War to over 200,000 miles by the close of the century. Inventions such as car couplers, air brakes, and Pullman passenger cars allowed the volume of both freight and people to increase steadily. From 1877 to 1890, both the amount of goods and the number of passengers traveling the rails tripled.

Financing for all of this growth came through a combination of private capital and government loans and grants. Federal and state loans of cash and land grants totaled $150 million and 185 million acres of public land, respectively. Railroads also listed their stocks and bonds on the New York Stock Exchange to attract investors from both within the United States and Europe. Individual investors consolidated their power as railroads merged and companies grew in size and power. These individuals became some of the wealthiest Americans the country had ever known. Midwest farmers, angry at large railroad owners for their exploitative business practices, came to refer to them as “robber barons,” as their business dealings were frequently shady and exploitative. Among their highly questionable tactics was the practice of differential shipping rates, in which larger business enterprises received discounted rates to transport their goods, as opposed to local producers and farmers whose higher rates essentially subsidized the discounts.

Jay Gould was perhaps the first prominent railroad magnate to be tarred with the “robber baron” brush. He bought older, smaller, rundown railroads, offered minimal improvements, and then capitalized on factory owners’ desires to ship their goods on this increasingly popular and more cost-efficient form of transportation. His work with the Erie Railroad was notorious among other investors, as he drove the company to near ruin in a failed attempt to attract foreign investors during a takeover attempt. His model worked better in the American West, where the railroads were still widely scattered across the country, forcing farmers and businesses to pay whatever prices Gould demanded in order to use his trains. In addition to owning the Union Pacific Railroad that helped to construct the original transcontinental railroad line, Gould came to control over ten thousand miles of track across the United States, accounting for 15 percent of all railroad transportation. When he died in 1892, Gould had a personal worth of over $100 million, although he was a deeply unpopular figure.

In contrast to Gould’s exploitative business model, which focused on financial profit more than on tangible industrial contributions, Commodore Cornelius Vanderbilt was a “robber baron” who truly cared about the success of his railroad enterprise and its positive impact on the American economy. Vanderbilt consolidated several smaller railroad lines, called trunk lines, to create the powerful New York Central Railroad Company, one of the largest corporations in the United States at the time. He later purchased stock in the major rail lines that would connect his company to Chicago, thus expanding his reach and power while simultaneously creating a railroad network to connect Chicago to New York City. This consolidation provided more efficient connections from Midwestern suppliers to eastern markets. It was through such consolidation that, by 1900, seven major railroad tycoons controlled over 70 percent of all operating lines. Vanderbilt’s personal wealth at his death (over $100 million in 1877), placed him among the top three wealthiest individuals in American history.

BIBILE QUESTION 30 POINTS PLEASE

Match the correct verses with the following five-point outline of Paul's Epistle to Philemon. Match the items in the left column to the items in the right column.

1. Salutation
Verses 8-21
2. Thanksgiving for Philemon's love, faith, and hospitality
Verses 4-7
3. Intercession on behalf of Onesimus
Verses 1-3
4. Personal request
Verse 25
5. Benediction
Verses 22-24

Answers

Answer:

1. Salutation

Ans: Verses 1-3

2. Thanksgiving for Philemon's love

Ans: Verses 4-7

3. Intercession on behalf of Onesimus

Ans: Verses 8-21

4. Personal Request

Ans: Verses 22-24

5. Benediction

Ans: Verse 25

Once you read Philemon in the Bible, you will see all these verses.

Please correct me if I am wrong.

Which best describes the cost of the Vietnam War in human terms?

an estimated 25,000 American servicemen and 757,143 Vietnamese dead

about 200,000 American servicemen and an estimated 4 million Vietnamese
dead

58,000 American servicemen and an estimated 1.5 million Vietnamese dead

58,000 American servicemen and an estimated 250,000 Vietnamese dead

Answers

Answer:

58,000 American servicemen and an estimated 250,000 Vietnamese dead

Explanation:

The estimated death toll of Us soldiers is 58,200 soldiers and around 200k - 250k vietnam soldiers perished.

Why are many people on the Caribbean islands poor?​

Answers

Answer:the Government must not love them lol

Explanation:

The Inca were able to oversee an empire that stretched for thousands of miles. Please describe one strategy that the Inca used to maintain political and social control.

Answers

Answer:

Division of power at various levels

Explanation:

The strategy the Inca used to able to oversee an empire that stretched for thousands of miles is "division of power at various levels."

While the mode of government is a monarchy, there are various positions under the emperor or king.

The king which was referred to as Sàpa Incan has the likes of viceroy, high priest, governors of a quarter, the council of the realm, inspectors, military generals, and other official to govern each domain or level of government. .

The empire was also divided into four known as Súyu; Chiñchay Súyu, Antî Súyu, Qúlla Súyu, and Kûnti Súyu. Each Súyu was divided into Wàmani. Each Wàmani was also divided into smaller groups headed by the empire officials.

Recognizing Bias What does Klemperer suggest about how most Germans felt about Hitler in 1938? Why do you think the German populace felt that way about Hitler?

Answers

Si f DC gtbfrbgfvfrv

After Pearl Harbor, FDR initiated?

Answers

What happened after the attack on Pearl Harbor?
After two hours of bombing, 21 U.S. ships were sunk or damaged, 188 U.S. aircraft were destroyed, and 2,403 people were killed. All of this happened while the U.S. and Japan were officially engaging in diplomatic negotiations for possible peace in Asia. The day after the attack, President Franklin D.
Almost as soon as the attacks occurred, conspiracy theorists began claiming that FDR had prior knowledge of the assault on Pearl Harbor. Others have claimed he tricked the Japanese into starting a war with the United States as a “back door” way to go to war with Japan’s ally, Nazi Germany. However, no document or credible witness has been discovered that proves either claim. Most scholars view Pearl Harbor as the consequence of missed clues, intelligence errors, and overconfidence.

On December 7, 1941 debate over American involvement in World War II ended abruptly. Isolationist sentiment disappeared and the nation emerged united and determined, in FDR’s words, to “win through to absolute victory.”

what did austria hungary do to serbia without german knowledge?

Answers

Explanation:

my guess is issue an ultimatum

4. Why was Napoleon Bonaparte such a significant figure in the history of nationalism?​

Answers

Answer:

Napoleon Bonaparte promoted French nationalism based upon the ideals of the French Revolution such as the idea of "liberty, equality, fraternity" and justified French expansionism and French military campaigns on the claim that France had the right to spread the enlightened ideals of the French Revolution across Europe

Explanation:

Other Questions
Is Roddy Rich Dead AKA, Did he die? what is Muscular system In the formula =C5*$B$3, C5 is what type of cell reference?relativeabsolutemixedobscure Please help I will give brainliest can someone please help me with this! Which joint injury is the result of running on hard surfaces or uphill?whiplashrotational injury at shouldershin splintsoveruse of elbow The area of a right triangle is 12 cm2. Which of the following could be the lengths of the legs of the triangle?2 cm and 6 cm4 cm and 6 cm3 cm and 2 cm3 cm and 4 cm What is the value of X in the equation. X- 4.3 = 2.5 Why were Julius and Ethel Rosenberg convicted of treason?They were proven to be spying for the USSR.They tried to attack the US with nuclear weapons.They brought USSR secrets to the US government.They wanted to leave the US to go live in the USSR. Which of the following is a true statement? A. Disruptions in an ecosystem are normal and natural changes.B. Disruptions in an ecosystem are caused by both human activity and environmental disturbances. C. Ecosystems are complex, interactive systems that include both biotic and abiotic components of the environment. D. All of these are true statements. A cylindrical soup can has a radius of 1.1 in. and is 5.4 in. tall. Find the volume of the can and round to the nearest tenths if necessary PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY