RNA: CATTGGCTAACGTCGATAATCGTCGGTAC
9. Which amino acids would be found in the mutation protein?
Which amino acids would be found in the mutation protein

Answers

Answer 1

Answer:

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.

Explanation:

This question is describing the process of translation, which is the second stage of protein synthesis. Translation is the process whereby a mRNA template is used to produce amino acids, which forms a sequence that will eventually become protein.

The mRNA sequence is read in a group of three nucleotides called CODON. Each codon specifies a particular amino acid. According to this question, using the genetic code table, the given DNA sequence is as follows:

DNA: CAT- TGG- CTA- ACG- TCG- ATA- ATC- GTC- GGT- AC

RNA = GUA- ACC- GAU- UGC- AGC- UAU- UAG- CAG- CCA- UG

Amino acid sequence: Valine- Threonine- Aspartic acid- Cysteine- Serine- Cysteine- Stop.


Related Questions

Jobs in agriculture have varying degrees of necessary education and experience.

O True
O False

Answers

Answer:

True

Explanation:

Agriculture has a misconception of just being farmers with no education- that is untrue. Farmers are required to know many things in order to preform in their job. You also need people to maintain and repair the equipment, someone to keep track of the seeds, etc. There are many Ag careers and majors in college.

The correct answer is True

Why human cell is consider as eukaryotic cell where as bacteria cell as prokaryotic cell?​

Answers

They do not have a nucleus or membrane organelles

The athletic trainer's role is always supplemental to the physician's course of action.
a. True
O b. False

Answers

The answer for this question is True

Decide if the following statements best describe map-based genome sequencing, best describe whole-genome shotgun sequencing, or apply equally to both sequencing methods.

a. starts with libraries of large, overlapping DNA fragments
b. starts cloning and sequencing of short, random DNA fragments
c. uses genetic recombination data to help arrange sequences correctly
d. requires sequences to be annotated after contig assembly
e. requires chromosome fragments to overlap for contig assembly
f. requires subcloning of large fragments into smaller clones for sequencing
g. is a better approach for repetitive sequences

1. Map-based genome sequencing
2. Whole-genome shotgun sequencing
3. Both sequencing methods

Answers

Answer:

1. Map-based genome sequencing: a; c; f; g

2. Whole-genome shotgun sequencing: b

3. Both sequencing methods: d; e

Explanation:

Map-based genome sequencing is a method that makes use of a reference genome sequence in order to determine the relative position of the DNA fragments before they are sequenced. This method is useful to determine the position of repetitive DNA fragments (for example, duplicated genes, repetitive non-coding regions, etc.) and Transposable Elements. Therefore, map-based genome sequencing is a suitable approach for large genomes (which are usually composed of repetitive sequences). On the other hand, in whole-genome shotgun sequencing, DNA sequences are obtained before the correct order of these DNA fragments is known. In this method, the genome is fragmented randomly into small DNA sequences (between 100 and 1000 base pairs), which are subsequently sequenced through the chain-termination sequencing approach (i.e., Sanger sequencing) and finally ordered by using bioinformatic tools that assemble overlapping reads.

Choose all the answers that apply.

Which of the following energy sources harms the
environment?

A.) coal
B.) hydroelectric power
C.) nuclear power
D.) oil

Answers

Answer:

c nuclear power because it destroy the places

Oil coal nuclear power

what is breathing and respiration?​

Answers

BREATHING:

Breathing is the process of moving air out in the lungs to facilitate gas exchange with the internal environment,mostly to flush out carbon dioxide and bring in oxygen.

RESPIRATION:

In physiology, respiration is the movement of oxygen from the outside environment to the cells within tissues, and the removal of carbon dioxide in the opposite direction.

Hope it Will be helpful to you.

I NEED HELP, can someone make do this real quick?

Answers

Answer:

The answer is A because abc

3. Some organelles are present in both plant and animal cells. Each organelle performs a different
function. Which of the functions listed below are performed by organelles found in both plants
and animals?

Answers

Answer:

Organelles that are present in both forms of eukaryotic cells are the following :

Nucleus

Endoplasmic Reticulum

Ribosomal units

Golgi apparatus

Lysosomes

Perixosomes

Mitochondrion

Cytoskeleton/Cytosol

Vacuole

Nucleolus

Plasma membrane

Microtubules/Microfilaments

All celluar functions corresponding to the organelles can be found in both plant and animal cells

Explanation:

plz make me the brainliest

The result of a magma plume rising and decompression melting occurring may
be the formation of a small volcanic region called a(n).

Answers

Hot spot: is the answer

The process of meiosis is illustrated here. The outcome of meiosis is very important in the sexual reproduction and life cycle of
diploid organisms. Evaluate these statements and determine which ones accurately describe the outcome of meiosis. You may select
ALL that apply.
-)
A)
Meiosis produces genetically diverse cells.
B)
Meiosis increases genetic variation in the offspring.
C)
Meiosis produces haploid cells from a diploid parent cell
D)
Meiosis increases the genetic content in the daughter cells.
E)
Meiosis maintains the number of chromosomes originally present in the
parent cell.

Answers

Answer:

A) Meiosis produces genetically diverse cells.

B) Meiosis increases genetic variation in the offspring.

C) Meiosis produces haploid cells from a diploid parent cell

Explanation:

Through crossing over, meiosis produces genetically diverse cells causing more genetic variation of offspring. The Daughter cells in meiosis are formed from a diploid cell that has all 46 chromosomes, however the daughter cells are haploids as they need to join with the other gamete to have a full set of chromosomes.

A species of organism has 6 pairs of homologous chromosomes. Which of the following would be the total number of possible chromosomal combinations in a zygote of the species?
A. 256 (2^8)
B. 4096 (2^12)
C. 128 (2^7)
D. 1024 (2^9)
E. 64 (2^6)

Answers

A I don’t know tho it could be wrong
B, because each species has one female and one male (2) and makes it 12 pairs

Which structure in the heart'separates
oxygenated blood from deoxygenated blood?

Answers

Answer:

pericardium

Explanation:

A double-walled membrane, the pericardium, separates the right and left chambers, preventing oxygen-rich blood from mixing up with the one without oxygen. So, the heart functions go smoothly. Deoxygenated blood enters the right atrium.

is the experience of losing a loved one and
is the emotional reaction to the loss.
grief; bereavement
bereavement; grief
widowing; distress
bereavement; solitude

Answers

Answer:

grief , bereavement

b/c the definition of grief is the experience of losing a loved one

Answer:

grisf breavement is the correct answer

it means the emotional situation of loosing a loved one

hope it is helpful to you

What has been the effect of globalization on agriculture?

O Broader teams are formed in the scientific community

O Crops are infested with new species of pests.

O The demand for food has exceeded the possible output

O A new market of food products has emerged.

Answers

broader teams are formed in the scientific community

                                         

which statement is correct about the polarity of a water molecule

Answers

Answer:

Water is Polar

Explanation:

There is no overall charge to a water molecule, but there is a slight positive charge on each hydrogen atom and slight negative charge on the oxygen atom.

Water is polar good luck

2)
A homeowner lives adjacent to some wetlands, which contain standing water for much of the year. During the summer months, the
mosquitoes in the area are excessive and pose a nuisance to the homeowner. The homeowner decides to spray an insecticide on
the lawn and adjacent wetlands to eradicate the mosquitoes. The homeowner notices that after the application of the insecticide,
the number of mosquitoes is significantly reduced.
The following year, the number of mosquitoes increases in frequency as the summer months arrive and the temperatures get
warmer. The homeowner once again applies the same insecticide to the yard and adjacent wetland areas. However, this time, the
homeowner does not notice a reduction in the mosquito population after applying the chemical.
Evaluate the scenario above and select ALL statement below that apply to this case study.
A)
B)
The insecticide no longer has a chemical that can kill any mosquitoes after
the first year.
The application of the insecticide caused directional selection in the
mosquito population
There were some mosquitoes with innate genetic resistance to the
insecticide before it was sprayed the first time.
C)
D)
Natural selection selects for a phenotype in a population that has an
advantage under certain environmental pressure.
E)
The application of the insecticide caused individual mosquitoes to mutate,
which made them resistance to the chemical.

Answers

Answer: B, C, and D

Explanation:

The application of the insecticide caused directional selection in the mosquito population. There were some mosquitoes with innate genetic resistance to the insecticide before it was sprayed the first time. Natural selection selects for a phenotype in a population that has an advantage under certain environmental pressure. The correct options are B, C, and D.

What is case study?

A case study is defined as 'an intensive study of a person, a group of people, or a unit with the goal of generalizing across several units'.

A case study has also been defined as a focused, systematic investigation of a single person, group, or community.

The insecticide application resulted in directional selection in the mosquito population. Before the insecticide was sprayed for the first time, some mosquitos developed innate genetic resistance to it.

Natural selection favors phenotypes in a population that have an advantage under certain environmental conditions.

Thus, B, C, and D are correct options.

For more details regarding case study, visit:

https://brainly.com/question/24259426

#SPJ2

Helicase is an enzyme responsible for unwinding the double helix of the DNA by breaking apart the hydrogen bonds between each of the base pairs. Which phase of the cell cycle is helicase most likely active? s M G1 G1​

Answers

Answer:

G1 Phase

Explanation:

name the consumers:

scavengers, omnivores, herbivores, carnivores

Answers

Answer:

Jaguars and frog are carnivorous, lizard is omnivorous, whereas sloth, monkey and butterfly

Explanation:

Jaguars, frog, lizards, are carnivorous which feeds on meat of other organism whereas sloth, monkey and butterfly are herbivorous which feeds on plants. Jaguar feeds on Capybaras, deer, tortoises, fish, birds and monkeys etc, frog feeds on insects and lizard also eats insects as well as plants so it is omnivorous while on the other hand, sloth lives on the trees so feed on plants, butterfly feeds on flower's nectar and monkey feeds on the fruits present on the trees.

what is deposition ?​

Answers

Answer:

it is a geological process where sediments, soil, and rocks are added to a landform or mass

Answer:

Deposition is defined as the removal from an office or the testimony of a witness under oath. An example of deposition is the firing of a person from a government job. An example of deposition is to tell the details of the crime to an attorney before the case goes to court

Explanation:

hope this helps

14. Which nitrogenous base isn't found in DNA?

Answers

Answer:

Uracil is a nitrogenous base found in all RNA but not present in DNA.

Explanation:

plz mark brainliest

Answer:

Uracil

Explanation:

Uracil is a base found in RNA (but not in DNA) and derived from pyrimidine; pairs with adenine. Uracil the nitrogenous based is not found in DNA.

So, the final answer is Uracil.

Which of the following parent combinations could result in a type o blooded child?​

Answers

Answer:

1 parent heterozygous A and 1 parent heterozygous B

Explanation:

One parent already has O and then the other is AB so its not a full dominate

1 parent heterozygous A and 1 parent heterozygous B could result in a type O blooded child. So, the correct option is D.

What is Blood group?

A blood type is defined as a classification of blood that is based on the presence and absence of antibodies and inherited antigenic substances on the surface of red blood cells. These antigens can be proteins, carbohydrates, glycoproteins, or glycolipids, depending on the blood group system.

There are 4 main blood groups which are- A, B, AB and O. Blood group is determined by the genes inherited from the parents. Each group can be RhD positive or RhD negative, which means there are 8 blood groups in total.

For the above example, when Heterozygous A blood group parents crossbreed with Heterozygous B blood group parents that is AO and BO respectively. AB, BO, AO and OO blood groups from the cross produce offspring.

Thus, 1 parent heterozygous A and 1 parent heterozygous B could result in a type O blooded child. So, the correct option is D.

Learn more about Blood group, here:

https://brainly.com/question/17052766

#SPJ6

What is the slowest moving weather front. Why
is it so slow?

Answers

Answer:

Cold fronts

Explanation:

Please select the word from the list that best fits the definition

movement of molecules from an area where there are many to an area where there are few

Answers

Answer:

Diffusion

is the movement of molecules from an area where there are many to an area where there are few

Hope it helps

You suggest using a logistic growth model instead. Your colleague agrees, and recommends harvesting the bass population down to just under carrying capacity. Their argument is that the population will remain large and population growth will be fastest if it is harvested down to this size. A) Why is this argument incorrect

Answers

Answer and Explanation:

The error of this argument is to state that a population will remain large and increase when it is close to the carrying capacity. This is because the carrying capacity is the term that determines that a population of living beings is living in an environment that has the minimum resources for their survival, because that population has already consumed the resources. In this case, when a bass population comes close to carrying capacity, the amount of environmental resources is starting to become scarce or limited, this will cause a decrease in the size of the population, because many members of the population will not have access to the necessary resources and will die, decreasing the population. In addition, reproduction among members of the population will be reduced, which will prevent the population from remaining large, since the mortality rate will be higher than the birth rate.

how did natural disasters affect animal populations?​

Answers

Answer:

When disasters hit, animals experience the same terrible effects as people: injury, starvation, thirst, displacement, illness and stress. We move fast to protect animals affected by earthquakes, floods, typhoons and other disasters. We provide food, water, medical care, and other emergency assistance to animals in need

Explanation:

What is a Beaver’s tail used for

Answers

Answer:

The tail is used as a rudder in swimming, as a balance prop while working on land and to signal danger when slapped on the water. Beavers will also store fat in their tails, eating more in the fall so they can survive off the fat stored in their tails through winter if food is not available.

Explanation:

PLS HELP WILL GIVE BRAINLIEST


CHECK ALL THAT APPLY

Answers

1, 4 and 5 are correct i believe

Why do cells use fat and starch for long term energy storage instead of atp molecules

Answers

Answer:

because it is hard to breakdown fat in a very short time while ATP can be broken down in a very short time.Fats have a very strong bond of molecular chains and this makes it hard to breakdown quickly

Jack bought a small turtle. Three months later, the turtle had grown to twice its original size. Which of the following statements best describes why Jack's turtle got bigger?

Answers

Answer:

he feeds his turtle then it ggrows

Explanation:

Describe a solar eclipse and when it occurs

Answers

A solar eclipse is where the moon and sun are aligned with each other. depending on totality it changes the way the day looks. If the totality is 100% it’ll be pitch black for about a few second up to a minute.
Other Questions
Could someone please help me with this homework assignment?Il pay 40 or more if u show work?...Send me a msg Write a short note on the topic ,' My Brother'. Why might the German ambassador have used such an elaborate code to send his message to Mexico? What qualities did Charlemagne possess that hurt his leadership ability? The ___ spoke to many different women's issues in 1848.A. Declaration of RightsB. Declaration of SentimentsC. Declaration of OrdersD. Declaration of SeparationE. Declaration of Independence Will give the brainiest if you give me an absolutely correct answer and an explanation. Please help meee. Read the paragraph below. Which transitional word or phrase belongs before sentence 6?(1) how are the photos repairs? (2) First, a new photo is taken of the damaged photo. (3) Next, a high-resolution camera and special lighting are used. (4) then, the new photo is viewed on a computer. (5) Most pictures take a few hours of work. (6) some take as long as a week.A. Despite,B. In spite of,C. Nevertheless,D. Once in a while, please someone help When a wolf eats a rabbit and then uses the energy from the rabbit torun, the wolf's body converts...O chemical energy to electrical energyO mechanical energy to chemical energyO thermal energy to mechanical energychemical energy to mechanical energy How did the Los Topos group get its name? Why is it important? How metals have been used thorough the ages PLS a diagram is shown, with angels labeled in degrees complete the sentences about the diagram linear relationships Can someone please help me with my test Navi-devices Inc., a manufacturer of portable navigation devices, provides free traffic updates and identifies the nearest parking spaces available with its latest device. It accomplishes this by using GPS coordinates of subscribers and traffic data from radio stations. Which of the following is the most likely impact of this strategy?a. It will improve the company's operations management.b It will improve their customer relationship management.c. It will lower their total revenue.d. It will provide the company with a competitive advantage. Please help need answers today.What is the best courses of action for the person shown below. Which of the following best summarizes the way in which the development of the factory system and the development of new transportation infrastructure such as railways worked together as factors facilitating British industrialization?The factory system produced the surplus labor that led large numbers of British people to emigrate overseas, and the new transportation infrastructure enabled those migrants to make their journeys.The factory system produced the surplus labor that led large numbers of British people to emigrate overseas, and the new transportation infrastructure enabled those migrants to make their journeys.AThe factory system concentrated the working classes in cities, and new transportation infrastructure allowed governments to better monitor and police these workers.The factory system concentrated the working classes in cities, and new transportation infrastructure allowed governments to better monitor and police these workers.BThe factory system concentrated production in relatively few locations, and the new transportation infrastructure allowed more goods and people to reach these locations in less time.The factory system concentrated production in relatively few locations, and the new transportation infrastructure allowed more goods and people to reach these locations in less time.CThe factory system led to an ever-greater degree of specialization of labor and, by doing so, helped meet the railway industrys need for highly skilled workers. 5 oraciones utilizando verbos poco comunes en ingles Based on the evidence provided, readers can conclude that Odysseus wants to rule his native land. is eager to leave his home. misses his native land. fears for the safety of his home. a bag of marbles contains 7 blue 3 red 11 yellow and 9 green barbles what is the probability that both randomly draws out a green marble followed by a purple marble is she doesn't put back the first marble The population of the world is roughly 7 x 10^9. The population of the United States is 3 x 10^8. How many times larger is the worlds population than the United States population?