when the polynomial is 4x^3-7x^2-10x-7 divided by x-3​

Answers

Answer 1

Answer:

21

Explanation:

Explanation:

one way of dividing is to use the divisor as a factor in

in the numerator

Answer 2
It is 21..... jjkiefjolvwahikvojckobgkyfjibnojno

Related Questions

Lo necesito hoy, por favor, ayúdalo y gracias
I need it for today please and thanks I will be giving brainliest

Answers

6 3/4 = length.

Work:

2 2/3 x 4 2/3 = 12 4/9

84 divided by 12 4/9 = 6 3/4

Volume = LxWxH
84 = 6 3/4 x 2 2/3 x 4 2/3

can someone please help meeee

Answers

Answer:

se cayóte caíste?me caíleyeronconstruimosse cayó

Explanation:

1.Se cayó
2.te caíste?
3.me caí
4.hicieron
5.construimos
6.se cayó

Verbos
Complete the chart with the correct verb forms.
Infinitivo
contar
(3)
mostrar
Meet

(1)
juegas
(5)
empiezas
nosotras
contamos
(4)
mostramos
(8)
ellos
(2)
juegan
(6)
empiezan
(2)

Answers

Answer:

The way you typed it in is kind of confusing but ill try my best haha

contar

mostrar

?

jugar

empezar

nosotras

contar

mostrar

ellos

jugar

empezar

Explanation:

hope this is ok

Tonight Paulo has a date with the woman of his dreams, Silvia. His friend Carlos tries to give him advice so that everything goes well on this important night. To find out what they say, fill in the blanks with the appropriate form of the verb. You have to read the conversation and understand the context in order to decide whether the verb should be in the present subjunctive or present indicative.

Carlos: Hola, Paulo, ¿qué me cuentas? ¿Cómo estás?
Paulo: ¡Estoy superbién! Sabes que Silvia por fin viene a visitarme; bueno, con tal de que yo enter answer (limpiar) la casa antes de que ella enter answer (venir).
Carlos: ¿Silvia? ¿Te va a visitar a ti? Pero tu casa es un desastre. ¿Qué vas a hacer para que Silvia no enter answer (asustarse) cuando enter answer (llegar)?
Paulo: Mira, Carlos, aunque mi casa enter answer (estar) un poco sucia, no es un desastre. La puedo limpiar.
Carlos: Pues, suponiendo que sí puedes limpiar la casa, ¿qué van a hacer Uds.?
Paulo: No lo sé. Creo que voy a bajar un video de Jackie Chan. Creo que a Silvia le va a gustar. Pero, en caso de que no le enter answer (gustar), también voy a bajar mi película favorita, The Hangover. Sé que con una de esas no puedo perder.
Carlos: ¡Paulo, Paulo! ¿Cuándo enter answer (ir) a aprender? ¿Cuántas veces te lo tengo que decir? Cuando enter answer (invitar) a tu casa a una chica como Silvia, tienes que enfocarte en ella. Tienes que preguntarle a ella qué quiere ver. Esta noche, pregúntale a Silvia qué quiere ver y entonces, cuando ella te enter answer (decir) el título de la película, Uds. dos pueden bajarla de Internet o ir juntos al Redbox.
Paulo: Entonces, ¿no crees que una película de Jackie Chan le vaya a gustar?
Carlos: Paulo, aunque le enter answer (gustar), tienes que esperar hasta que ella
enter answer (decidir) qué es lo que prefiere ver. ¡Qué cabezota (stubborn person) eres!

Answers

Paulo: limpie , venga

Carlos: se asuste , llegué

Paulo: esta

Paulo: guste

Carlo: iras , invites , diga

Carlos: guste , diga

The correct conjugation of the verbs in the conversation, in Indicative or Subjunctive form, is:

Carlos: Hola, Paulo, ¿qué me cuentas? ¿Cómo estás?

Paulo: ¡Estoy superbién! Sabes que Silvia por fin viene a visitarme; bueno, con tal de que yo limpie la casa antes de que ella venga.

Carlos: ¿Silvia? ¿Te va a visitar a ti? Pero tu casa es un desastre. ¿Qué vas a hacer para que Silvia no se asuste cuando llegue?

Paulo: Mira, Carlos, aunque mi casa esté un poco sucia, no es un desastre. La puedo limpiar.

Carlos: Pues, suponiendo que sí puedes limpiar la casa, ¿qué van a hacer Uds.?

Paulo: No lo sé. Creo que voy a bajar un video de Jackie Chan. Creo que a Silvia le va a gustar. Pero, en caso de que no le guste, también voy a bajar mi película favorita, The Hangover. Sé que con una de esas no puedo perder.

Carlos: ¡Paulo, Paulo! ¿Cuándo vas a aprender? ¿Cuántas veces te lo tengo que decir? Cuando invitas a tu casa a una chica como Silvia, tienes que enfocarte en ella. Tienes que preguntarle a ella qué quiere ver. Esta noche, pregúntale a Silvia qué quiere ver y entonces, cuando ella te diga el título de la película, Uds. dos pueden bajarla de Internet o ir juntos al Redbox.

Paulo: Entonces, ¿no crees que una película de Jackie Chan le vaya a gustar?

Carlos: Paulo, aunque le guste, tienes que esperar hasta que ella  decida qué es lo que prefiere ver. ¡Qué cabezota eres!

Conjugation in Indicative Form.

The conjugation of the verbs in parenthesis, in indicative present form, taking into account the personal pronouns, is:

Yo: limpio / vengo / me asusto / llego / estoy / me gusta / voy / invito / digo / decido.Tú: limpias / vienes / te asustas / llegas / estás / te gusta / vas / invitas / dices / decides.Usted: limpia / viene / le asusta / llega / está / le gusta / va / invita / dice / decide.Él: limpia / viene / le asusta / llega / está / le gusta / va / invita / dice / decide.Ella: limpia / viene / le asusta / llega / está / le gusta / va / invita / dice / decide.Ello: limpia / viene / le asusta / llega / está / le gusta / va / invita / dice / decide.Nosotros / Nosotras: limpiamos / venimos / nos asustamos / llegamos / estamos / nos gusta / vamos / invitamos / decimos / decidimos.Ustedes: limpian / vienen / les asusta / llegan / están / les gusta / van / invitan / dicen / deciden.Ellos / Ellas: limpian / vienen / les asusta / llegan / están / les gusta / van / invitan / dicen / deciden.

Subjunctive Form.

The subjunctive form in Spanish is used to mention events of which it is not certain that they will occur (such as what will happen in the quote from Paulo and Silvia). The conjugation in subjunctive form, taking into account the personal pronouns is:

Yo: limpie / venga / me asuste / llegue / esté / me guste / vaya / invite / diga / decida.Tú: limpies / vengas / te asustes / llegues / estés / te guste / vayas / invites / digas / decidas.Usted: limpie / venga / le asuste / llegue / esté / le guste / vaya / invite / diga / decida.Él: limpie / venga / le asuste / llegue / esté / le guste / vaya / invite / diga / decida.Ella: limpie / venga / le asuste / llegue / esté / le guste / vaya / invite / diga / decida.Ello: limpie / venga / le asuste / llegue / esté / le guste / vaya / invite / diga / decida.Nosotros / Nosotras: limpiemos / vengamos / nos asustemos / lleguemos / estemos / nos guste / vayamos / invitemos / digamos / decidamos.Ustedes: limpien / vengan / los asuste / lleguen / estén / les guste / vayan / inviten / digan / decidan.Ellos / Ellas: limpien / vengan / los asuste / lleguen / estén / les guste / vayan / inviten / digan / decidan.

Since most of the conversation was based on hypothetical situations about what would happen when Silvia arrived at Paulo's house, the vast majority of conjugations are in the subjunctive form.

The only indicative conjugations were those where Carlos gives Paulo situational advice, that is, where he tells him what to do step by step, directly.

More information:

https://brainly.com/question/10444148?referrer=searchResults

mr karki earns rs9600 in a month . he spends 15%of his earning on the education of his children and 25% on food
i find his total expense on education and food
ii how much does she save in a month ??
iii How much does he save in a year ??
iv if he spends 80% of his annual saving to buy a piece of land , What is the cost of the land ????



please anybody help me ​

Answers

Answer:

i. 3840 rs

ii. 5760 rs

iii. 69120 rs

IV 55296 rs

Explanation:

15 + 25 = 40%= 40/100 = 0.4

9600 *0.4 = 3840

9600 - 3840 = 5760

5760*12 = 57600 + 11520 = 69120

80% = 80/100 = 0.8

69120*0.8 = 69120-13824 = 55296

Patricio is talking with Silvina about his date with Laura last night. Complete his conversation with the appropriate forms of the verbs in the preterite.

Silvina: Dime, Patricio, ¿


enter answer

(divertirse) anoche con Laura?

Patricio: Bueno, sí y no. Ella sí


enter answer

(divertirse) conmigo, pero no sé si yo realmente


enter answer

(divertirse) con ella. ¿Sabes?

Silvina: Pues, cuéntame. ¿Qué pasó?

Patricio: Mira, yo


enter answer

(conseguir) mi primera tarjeta de crédito y, para impresionar a Laura, yo


enter answer

(sugerir) ir a ese restaurante caro en el centro. Ella dijo que sí. Esa noche yo


enter answer

(vestirme) muy elegantemente y…

Silvina: ¿También


enter answer

(vestirse) Laura elegantemente?

Patricio: Sí, Laura estaba muy linda. Bueno, llegamos al restaurante y el mesero nos


enter answer

(servir) unas copas de vino tinto. Pero entonces Laura


enter answer

(pedir) una botella de champán muy caro.

Silvina: ¿Qué hiciste?

Patricio: Pues, en ese momento


enter answer

(preferir) no decir nada, así que simplemente


enter answer

(sonreír) y no dije nada.

Silvina: ¿Qué


enter answer

(pedir) tú para comer?

Patricio: Yo


enter answer

(pedir) el pollo asado, pero ella


enter answer

(preferir) comer la langosta y el bistec.

Silvina: ¿La langosta y el bistec? Esa chica sí que tiene gustos muy caros, ¿no? ¿Y hablaron mucho durante la cena?

Patricio: Sí, hablamos mucho y ella


enter answer

(reírse) mucho. Yo diría (would say) que durante la cena nosotros sí


enter answer

(divertirse) mucho. Pero cuando el mesero me trajo la cuenta, yo casi


enter answer

(morirse) de miedo.

Silvina: ¿Cuánto costó la cena?

Patricio: ¡12.000 bolívares!

Silvina: ¡Caray!

Patricio: Sí, y después de pagar la cena, Laura


enter answer

(sugerir) ir a tomar copas y escuchar música en algún bar. Pero cuando yo le dije que mi tarjeta de crédito ya no podía más (couldn't take it anymore), ella dijo que se sentía (she felt) enferma.

Silvina: ¡No me digas!

Patricio: Sí. Es la pura verdad. Entonces, nosotros


enter answer

(despedirse) y yo fui a casa y


enter answer

(dormirse) en seguida.

Silvina: ¿Y la pobre tarjeta de crédito?

Patricio: ¡Yo creo que la pobre tarjeta ya


enter answer

(dormirse) para siempre!

Answers

Answer:

Silvina: Dime, Patricio, ¿ te divertiste

anoche con Laura?

Patricio: Bueno, sí y no. Ella sí se divirtió conmigo, pero no sé si yo realmente me divertí con ella. ¿Sabes?

Silvina: Pues, cuéntame. ¿Qué pasó?

Patricio: Mira, yo conseguí mi primera tarjeta de crédito y, para impresionar a Laura, yo sugerí ir a ese restaurante caro en el centro. Ella dijo que sí. Esa noche yo me vestí muy elegantemente y…

Silvina: ¿También se vistió Laura elegantemente?

Patricio: Sí, Laura estaba muy linda. Bueno, llegamos al restaurante y el mesero nos sirvió unas copas de vino tinto. Pero entonces Laura pidió una botella de champán muy caro.

Silvina: ¿Qué hiciste?

Patricio: Pues, en ese momento preferí no decir nada, así que simplemente sonreí y no dije nada.

Silvina: ¿Qué pediste tú para comer?

Patricio: Yo pedí el pollo asado, pero ella prefirió comer la langosta y el bistec.

Silvina: ¿La langosta y el bistec? Esa chica sí que tiene gustos muy caros, ¿no? ¿Y hablaron mucho durante la cena?

Patricio: Sí, hablamos mucho y ella se rió mucho. Yo diría que durante la cena nosotros sí nos divertimos mucho. Pero cuando el mesero me trajo la cuenta, yo casi me morí de miedo.

Silvina: ¿Cuánto costó la cena?

Patricio: ¡12.000 bolívares!

Silvina: ¡Caray!

Patricio: Sí, y después de pagar la cena, Laura sugirió ir a tomar copas y escuchar música en algún bar. Pero cuando yo le dije que mi tarjeta de crédito ya no podía más, ella dijo que se sentía enferma.

Silvina: ¡No me digas!

Patricio: Sí. Es la pura verdad. Entonces, nosotros nos despedimos y yo fui a casa y me dormí en seguida.

Silvina: ¿Y la pobre tarjeta de crédito?

Patricio: ¡Yo creo que la pobre tarjeta ya se durmió para siempre!

Explanation:

Answer:

Here are

Patricio is talking with Silvina about his date with Laura last night. Complete his conversation with the appropriate forms of the verbs in the preterite.

Silvina: Dime, Patricio, ¿

Correct answer te divertiste

te divertiste

(divertirse) anoche con Laura?

Patricio: Bueno, sí y no. Ella sí

Correct answer se divirtió

se divirtió

(divertirse) conmigo, pero no sé si yo realmente

Correct answer me divertí

me divertí

(divertirse) con ella. ¿Sabes?

Silvina: Pues, cuéntame. ¿Qué pasó?

Patricio: Mira, yo

Correct answer conseguí

conseguí

(conseguir) mi primera tarjeta de crédito y, para impresionar a Laura, yo

Correct answer sugerí

sugerí

(sugerir) ir a ese restaurante caro en el centro. Ella dijo que sí. Esa noche yo

Correct answer me vestí

me vestí

(vestirme) muy elegantemente y…

Silvina: ¿También

Correct answer se vistió

se vistió

(vestirse) Laura elegantemente?

Patricio: Sí, Laura estaba muy linda. Bueno, llegamos al restaurante y el mesero nos

Correct answer sirvió

sirvió

(servir) unas copas de vino tinto. Pero entonces Laura

Correct answer pidió

pidió

(pedir) una botella de champán muy caro.

Silvina: ¿Qué hiciste?

Patricio: Pues, en ese momento

Correct answer preferí

preferí

(preferir) no decir nada, así que simplemente

Correct answer sonreí

sonreí

(sonreír) y no dije nada.

Silvina: ¿Qué

Correct answer pediste

pediste

(pedir) tú para comer?

Patricio: Yo

Correct answer pedí

pedí

(pedir) el pollo asado, pero ella

Correct answer prefirió

prefirió

(preferir) comer la langosta y el bistec.

Silvina: ¿La langosta y el bistec? Esa chica sí que tiene gustos muy caros, ¿no? ¿Y hablaron mucho durante la cena?

Patricio: Sí, hablamos mucho y ella

Correct answer se rio

se rio

(reírse) mucho. Yo diría (would say) que durante la cena nosotros sí

Correct answer nos divertimos

nos divertimos

(divertirse) mucho. Pero cuando el mesero me trajo la cuenta, yo casi

Correct answer me morí

me morí

(morirse) de miedo.

Silvina: ¿Cuánto costó la cena?

Patricio: ¡12.000 bolívares!

Silvina: ¡Caray!

Patricio: Sí, y después de pagar la cena, Laura

Correct answer sugirió

sugirió

(sugerir) ir a tomar copas y escuchar música en algún bar. Pero cuando yo le dije que mi tarjeta de crédito ya no podía más (couldn't take it anymore), ella dijo que se sentía (she felt) enferma.

Silvina: ¡No me digas!

Patricio: Sí. Es la pura verdad. Entonces, nosotros

Correct answer nos despedimos

nos despedimos

(despedirse) y yo fui a casa y

Correct answer me dormí

me dormí

(dormirse) en seguida.

Silvina: ¿Y la pobre tarjeta de crédito?

Patricio: ¡Yo creo que la pobre tarjeta ya

Correct answer se durmió

se durmió

(dormirse) para siempre!

Explanation:

escribe la oracion expresa lo opuesto en cada ocasion
modelo: no es seguro nuestro hijo se independice -- es seguro que nuestro hijo se independiza
1 no es cierto que David sea infeliz.
2 No es evidente que ella esté preparada
3 Es verdad que es un adolescente rebelde
4 Estoy segura de que tu hermano es mandón
5 No creo que mi esposo esté despierto

Answers

Answer:

Explanation:

1 Es cierto que David es infeliz

2 Es evidente que ella está preparada

3 No es verdad que sea un adolescente rebelde

4 No estoy segura de que tú hermano sea un mandón

5 Creo que mi esposo está despierto

Mapa de América croquis ​

Answers

Answer:

map of america stretches

Explanation:

PLEASE MARK ME BRAILEST

Please help due today

Answers

1. A coffee shop

2. Home

3. The library

4. School

5. Kitchen


1. Una cafetera

2. A casa

3. La biblioteca

4. La escuela

5. La cocina


Wasn’t sure if you needed it in Spanish or English so I wrote both

Traduzca la siguiente frase.
The girls always compete.
A. Los muchachos siempre compiten.
B. A las muchachas también les gusta competir.
C. Las muchachas siempre compiten.
D. A los muchachos también les gusta competir.

Answers

The answer will be C

Answer:

C. Las muchachas siempre compiten.

Explanation:

im hispanic

Who were the cronistas of the New World, and how did they influence it? Write your answer
English.

Answers

Answer:

A Cronista is someone who chronicles or records history. The Cronista took note of things that happened during the spanish conquest.

Explanation:

It should be noted that a cronista is someone who chronicles or records history.

Who is a Cronista?

A cronista takes information and put it in order. They can alter how things are seen or leave out things that may have happened to influence, alter, or change the way people understand history.

The cronista took note of things that happened during the Spanish conquest and only consider their own point of view.

Learn more about history on:

https://brainly.com/question/24466312

Yo ___ las mallas para el invierno.

necesito

vendo

pregunto

pruebo

Answers

Yo vendo las mallas para el invierno
yo necesito
Because mallas are leggings so it says I need the leggings for the winter.

Is the verb “marcar” in the correct format?

Nuestro equipo necesita marca mas puntos pars ganar el partido.

Answers

Nuestro equipo necesito Marca mas puntos pars ganar
No
It is suppose to say: Nuestro equipo necesita MARCAR más puntos para ganar el partido.

Escoge.
Los padrinos celebran_____Del_________en la iglesia.

1)el cumpleaños, novio
2)el bautizo, recién nacido
3)la recepción, paje
4)el matrimonio, bebé

Answers

La persona de arriba tiene su respuesta correcta.
The person on top has his/her answer correct.

Please help with my spanish!! I'm begging

Answers

Answer:

I can help!

Explanation:

I am Puerto Rican I can surely help

compara la representación del individuo en su entorno en las dos obras en relación con el existencialismo.

He andado muchos caminos,
he abierto muchas veredas;
he navegado en cien mares,
y atracado en cien riberas.
En todas partes he visto
caravanas de tristeza,
soberbios y melancólicos
borrachos de sombra negra,
y pedantones al paño
que miran, callan, y piensan
que saben, porque no beben
el vino de las tabernas.
Mala gente que camina
y va apestando la tierra...
Y en todas partes he visto
gentes que danzan o juegan,
cuando pueden, y laboran
sus cuatro palmos de tierra.
Nunca, si llegan a un sitio,
preguntan a dónde llegan.
Cuando caminan, cabalgan
a lomos de mula vieja,
y no conocen la prisa
ni aun en los días de fiesta.
Donde hay vino, beben vino;
donde no hay vino, agua fresca.
Son buenas gentes que viven,
laboran, pasan y sueñan,
y en un día como tantos,
descansan bajo la tierra.
Antonio MachadoPoesías completasMadrid: Espasa-Calpe, 2006.(Originalmente se publicó en Soledades, galerías y otros poemas en 1907).
The figure presents a painting titled “Toronto Skyline” by Mike Parsons. In the background of the painting there is a vast jumbled city scape with towering buildings leaning in different directions. In the foreground of the painting, bumper to bumper traffic packs the roads, while a large group of people is shown in the street.

Answers

Answer:

..... .jejeejejeshe8ehejjeje

please correct answer!

Answers

Answer:

ese día vimos a mi hija rezando

How would you say "We learned to dive" in Spanish.

A. Aprendimos a bucear.

B. Aprendió a montar a caballo.

C. Aprendiste a pasear en bote.

D. Aprendisteis a descansar.

Answers

Answer:

Hi! The answer is A.

Explanation

The rest of the answers don't make any sense, as they translate into meaning other than "We learned to dive". They translate to:

B. We learned to ride a horse

C. You learned to ride on a boat.

D. You learned how to rest.

Llene el espacio en blanco con los artículos adecuados para los siguientes sustantivos.
Pueden ser artículos definidos (el, la, los, las) y sus contracciones (de + el = del, a + el = al) o
artículos indefinidos (un, una, unos, unas). Si no se requiere nada escriba un cero (O).
(Help pleaseee)

Answers

El
El
Al
El
El
La
Del
El
Al
Los

Answer:

11 el

12 el

13 al

14 el

15 el

16 La

17 del

18 el

19 al

20 los

Explanation:

cuales son los sucesos reales de la leyenda del cipitio​

Answers

Answer:

hola :3

Explanation:

:vvvvvvvvvv. vv

1- un suceso real es que el es un ser que le gusta jugar y bromear con las mujeres que miraba en los ríos lavando su ropa, ellas contaban que el les quitaba sus cosas, les jalaba del pelo, o las asustaba.
2- se decía que el comía ceniza y eso le causaba tener el estómago grande.
3- es hijo de la siguanaba.

En qué se centra la democracia como modelo social y político​

Answers

With its emphasis on notions of social contract and the collective will of all the voters, democracy can also be characterised as a form of political collectivism because it is defined as a form of government in which all eligible citizens have an equal say in lawmaking.

Social democracy is a government system that has similar values to socialism, but within a capitalist framework. The ideology, named from democracy where people have a say in government actions, supports a competitive economy with money while also helping people whose jobs don't pay a lot.


(I’m sorry I really don’t speak Spanish like that but if you want me to translate it for you I can!! )

Answer:

debajo de

Explanation:

a democracia participativa es un modelo de democracia en el que los ciudadanos tienen el poder de decidir directamente sobre la política y los políticos son responsables de aplicar esas decisiones políticas.

La siguiente respuesta dice:

La socialdemocracia es un sistema de gobierno que tiene valores similares al socialismo, pero dentro de un marco capitalista. La ideología, llamada de la democracia donde la gente tiene voz en las acciones del gobierno, apoya una economía competitiva con dinero mientras que ayuda a la gente cuyos trabajos no pagan mucho.

Nosotros ____
buenas notas en las clases.

Answers

Nosotros “tenemos” buenas notas en las clases.

Nosotros tenemos buenas notas en las clases.

Tenemos es la palabra que falta / ”Tenemos” is the word missing.

What does the underlined word mean in the following sentence?

¿Cuál es la dirección?
address
corner
mile
city block

Answers

first :: address is the correct answer
What is the address is the answer

Pls help!!! will give brainly!!!
how to say in spaish?
when it is spring i pick flowers with my friends

Answers

Cuando es primavera escojo flores con mis amigos

i just got out of jail but i did (domestic violence)
all i did was drow some hand with my mom she said no more fortnight

Answers

Answer:

._.

Explanation:

:O........................

What is used in Spanish for questions, but not in English? *

a question mark

an upside down/backward question mark at the beginning

no question mark

all of the above

Answers

Answer:

an upside down/backward question mark at the beginning

Explanation:

That way, you can tell its a question from the beginning of the sentence.

Answer: B

Explanation:

¿Quiénes están más felices el Día de Reyes?

los niños
los camellos
los reyes magos

Answers

Answer:

Los niños son los que están más felices el Día de Reyes.

los niños porque Ellos recibir regalos.

HELPPPPPPPPPPPPPPPPP

Answers

Answer:

Nos estrellamos

Explanation:

Helena y yo nos estrellamos

Please help!!!!!! I

Answers

al ,una,La,las,la,del,las,la,Las,al
Al, una, la, las, la, del, unas, la, las, al

Mis Padres y yo ____ de colorado.
A) estamos
B) estoy
C) somos
D)son

Answers

Answer:

Somos

Explanation:

Answer:

C) somos

Explanation:

Mis padres y yo somos de colorado. When you say somos, it is like your saying we are from colorado and that is what the sentence is talking about.

Other Questions
What is the distance between (3, -2), (2, -4)? Brad found Middle C on the piano writerA) any note he wanted it to beB) to the left of the three black notes at the bottomC) to the left of the 2 black notes in the middleD) to the right of the 2 black notes in the middle Determine which equation has the same solutions as the given equation.x2 10x 11 = 0A. (x 10)2 = 36B. (x 5)2 = 36C. (x 5)2 = 21D. (x 10)2 = 21 if you subtract 17 from my number and multiply the difference by -6 the results is -138 what is Sarah's number Find the volume for the regular pyramid.6 cu. units12 cu. units4 cu. units What role does Janes ambiguous social position play in determining the conflict of her story? (its based on the book Jane eyre)I need this ASAP! DQuestion 2If a right triangle has side lengths 6, 6.7 and 3, which side is the hypotenuse?O 3O 6.7O 15.706 What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution?