This man was a supporter of the states' rights position.
a. David Levitt
b. Cheif jusice Roger B. Taney
c. Franklin D. Roosevelt
d. Richard Nixon

Answers

Answer 1

Answer:

[tex]a. \: david \: levitt \\ \\ \\ \\ \\ \\ i \: think \: so \: if \: it \: is \: helpfull \: f[/tex]


Related Questions

Evaluative listening is successful when we

Answers

Answer:xd

Explanation:

how a positive personal life plan may promote meaningfulness of life​

Answers

Answer: A positive personal lifestyle plan gives you goals and reasons to get up in the morning and pursue. This plan allows you to set milestones that can be easily reached with effort. Once a milestone is hit you can immediately see the results and visualize the progress you have made which helps motivate you even more.

what is adolescence

Answers

Explanation:

A young person between being a child and being an adult

the period following the onset of puberty during which a young person develops from a child into an adult.

Whittier used imagery and symbols to depict the struggle between the North and the South over the issue of slavery. For example, in the first verse, "East" refers to the northeastern states that were free of slavery. Kansas Territory is the "West" to which Whittier wants to bring "the homestead of the free." What references to the North and the South can you find?

Answers

Answer:

A reference to the North about slavery would be the North Star (symbol of hope and optimism). A reference for the South in slavery would be a jail cell for how incriminating it felt to be treated as property..

If the temperature at the foot of a mountain is
29°C, what will be the temperature at its
summit if the mountain is 4000m high?​

Answers

Answer:

-1⁰C

Explanation:

Trust me I am pro.

please like and sub for more content

The arrows on the two maps below show how the monsoon winds over India change direction with the seasons.

Answers

Answer:

D

Explanation:

D, winter is cooler and more humid than summer.

The monsoon winds affects the India in summer and winter because:

D, winter is cooler and more humid than summer.

What is the monsoon wind?

The monsoon winds is associated with a seasonal change in the direction of the strongest winds of a region.

Hence, the monsoon winds affects the India in summer and winter because winter is cooler and more humid than summer.

Therefore, the Option D is correct.

Read more about monsoon wind

brainly.com/question/21280463

For my own part, I should not like to think that I ever rely on the protection of the State. But, if I deny the authority of the State when it presents its tax-bill, it will soon take and waste all my property, and so harass me and my children without end. This is hard. This makes it impossible for a man to live honestly, and at the same time comfortably, in outward respects.
—Civil Disobedience, Henry David Thoreau, 1849


Which statement best reflects Henry David Thoreau's perspective on taxation efforts during the Mexican-American War?

Answers

Answer:

Could we get the statement options?

What’s the correct answer

Answers

The correct answer is C. Visual pollution includes trash, wooden planks, and signs that mess up our landscapes.

Explanation

Visual contamination is the presence of visual elements that interrupt the aesthetics and overall perception of a landscape. It is usually found in large cities where there are a large number of billboards, lights, signs, antennas, cables, poles, advertisements, fenced areas, among other visual objects that disrupt the landscape in general. Therefore, it can be considered that the correct option is C. because all the objects mentioned aggressively break into the harmony of a landscape.

Why do you think it's important to have words to describe people's lived experience?

Brainly if u give me a good explanation!

Answers

Answer:

“We can learn so much about people’s lives and trends in history by concentrating on the actual personal experiences as they were lived. To me, each person is the authority on his or her own experience.”

Hapshires are often used as sires in what kinds of operations?

Answers

They are often used as a meat breed and are bred to the York for large litters the York is know as the mother breed and the off spring is used for processing only

How did Jimmy reply when Bobby told someone that one day Jimmy would be President
of the United States?

Answers

Answer:This isnt answerable, i need context

Explanation:

Hello community, i need the answer to this please!!

Answers

Only if u help me I'll help u

Which of the following best describes nativists' views on Chinatowns?
O They believed Chinatowns were unlike other parts of a city and should not exist.
The believed Chinatowns were dangerous but necessary to promote assimilation into American culture.
O They believed Chinatowns were strange, but they added rich culture to a city.
O They believed Chinatowns were necessary because they segregated immigrants from other parts of the city.

Answers

Answer:

The Answer is A. O They believed Chinatowns were unlike other parts of a city and should not exist.

Explanation:

Answer:

A.

They believed Chinatowns were unlike other parts of a city and should not exist.

Explanation:

How do you view your life at the moment? is it good or bad why?​

Answers

Answer:

good

Explanation:

because im answering a free question

how to increase memory power ?give some tips.​

Answers

Answer:

if you want to help increase your memory heres a few things that may help.

Explanation:

-do puzzles and Brain teasers to get your motor skills running

-Drink Water

-Less screen time

-try to get more sleep

Answer:

we can increase our memory power in the following ways

drinking sufficient water reading news trying to solve hard questions which you don't knowDehydrating your body having foods which are rich in vitamin , proteins,and minerals etc .

hope it is helpful to you ☺️☺️☺️☺️☺️☺️☺️☺️

Explain some of the reasons why the 2010 earthquake in Haiti was more destructive than the 2010 earthquake in Chile.

Answers

Answer:

its epicentre was close to a major city and its hypocentre, or focal point, was close to the Earth's surface

Explanation:

Answer:

Although the 2010 earthquake in Haiti registered lower on the Richter Scale than the one in Chile a month later, the Haiti quake was far more destructive. Haiti is a poorer country and has few resources to prepare for or cope with a massive earthquake. Unlike Chile, which has strict building codes, Haiti has poor construction, which is why most of the buildings in the capital city collapsed. Chile, having learned from experience from a devastating quake in 1960, not only has strict building codes, but also has safety training and school drills for dealing with an earthquake. The quake in Haiti also struck a major metropolitan area, while the Chile quake occurred about 70 miles from a large city. The death toll in Haiti was over 250,000, compared to less than 1,000 in Chile.

Explanation:

Life Orientation/Grade 12
NSC
MDE/ SBT/2021
1.2 Mention THREE reasons why the ability to adapt to change is important for
improvement of your quality of life.
(3x1) (3)​

Answers

Answer:

Ability to adapt prevent us from conflicts, help us evolve with the trend and make us more lovable

Explanation:

Three reasons as to why the ability to adapt to change is important for

improvement of quality of life are as follows -

a) Ability to adapt prevent us from conflicts based on view points, changing time and age difference.

b) Ability to adapt  help us evolve with the trend and hence keep us in line with the growing world.

c) Ability to adapt make us seen as a good and understandable person in eyes of other and hence make us more lovable.

The reasons why the ability to adapt to change is important for improvement of your quality of life is that:

Adaptation helps one to be opens in their mind to new ideas.It is one that makes a person to question the status quo.It is one that gives on the zeal or willingness to go against other convention.

Why is it important to adapt to change?

The ability to handle change will help one in life and also in businesses so that one can find and nurture themselves as well as their ideas and opportunities.

Adaptable people are said to be ones that are not scared of change, as make the right plans to adjust to it.

Learn more about Life Orientation from

https://brainly.com/question/4911473

"The proposed Constitution, so far from implying an abolition of the State governments, makes them constituent parts of the
national sovereignty, by allowing them a direct representation in the Senate, and leaves in their possession certain exclusive
and very important portions of sovereign power. This fully corresponds ... with the idea of a federal government."
--Alexander Hamilton, 1787
What concept was Hamilton defining?
democracy
b. nationalism
a.
c. socialism
d. federalism
Please select the best answer from the choices provided

Answers

Answer:

AARON BURR SIR

ITS D BTW

Explanation:

10. To______
the money supply, the Fed could______
3 point
A. decrease; lower the reserve requirements
B. increase; lower the discount rate
C. increase; conduct open-market sales
D. decrease; lower the federal funds rate
E. decrease; raise income taxes.

Answers

Answer:When the Federal Reserve decreases the reserve ratio, it lowers the amount of cash that banks are required to hold in reserves, allowing them to make more loans to consumers and businesses. This increases the nation's money supply and expands the economy.

Explanation:

What are examples of special districts in Louisiana? Check all that apply.

school districts
library districts
levee districts
voting districts
water usage districts
sanitation districts
voting districts

Answers

Answer:

bcef is right

Explanation:

edge

The library districts, levee districts, water usage districts and the sanitation districts are examples of special districts in Louisiana. Thus, option (b), (c), (e) and (f).

What is districts?

Districts are the territorial subdivisions of the region, nation, and city. Administrative and judicial goals are at stake. A House of Representatives, the Senate, or judicial circuit is a legislative district. A district is a geographic area inside a country, city, or town where document official business.

Library districts, levee districts, water usage districts, and sanitation districts are all different. There are Louisiana districts that are managed differently based on the content. There are districts based on the water usage districts and the library districts.

As a result, the library districts, levee districts, water usage districts and the sanitation districts are examples of special districts in Louisiana.

Learn more about on district, here:

https://brainly.com/question/28378886

#SPJ2

What is a territory?
A. A unique area of land with a population and physical features
B. An area of land or water under the control of a government
C. Any area of land surrounded on all sides by water
D. An area of land that is taking steps to become a state

Answers

Answer:

B. An area of land or water under the control of a government

Explanation:

An area of land under the jurisdiction of a ruler or state:

"the government was prepared to give up the nuclear weapons on its territory"

A territory is an area of land or water under the control of a government. Thus, the correct option is (B).

What is a territory?

Territory is a term used to describe a region of land that is under the control of a ruler or state. It is a region of land, water, or space that is associated with, or belongs to, a specific nation, individual, or animal.

A territory, in the context of international politics, is either the entire area from which a state may derive its power or an administrative division, that is, a region that is subject to the control of a sovereign state.

In most nations, a territory is an organized division of a region that is under a nation's control but has not yet been formally developed into or incorporated into one of the nation's political units, which political units are of equal status to one another and are frequently referred to by words like "provinces", "regions", or "states".

Therefore, an area of land or water under the control of a government is known as the territory.

To learn more on territory, click here:

https://brainly.com/question/1228531

#SPJ3

1. The name "Islamabad" can be translated as
Holy Father
O Blessed Allah
O Home of Peace
Beginning of Islam

Answers

Answer:

Home of Peace

Explanation:

seen it in the video

What is the difference between a meteor and a meteorite?

A : A meteor orbits the sun while a meteorite orbits the Earth.

B : A meteor is a meteorite which has reached the Earth's surface.

C : A meteorite is a meteor which has reached the Earth's surface.

D : A meteorite has a nucleus and tall but a meteor does not.

Answers

C i believe if not sorry

Which government is more similar to the government of the United States?
1. Great Britain
2. Mexico
3. China
4. Canada

Answers

Answer:

4

Explanation:

Canada shares a border with the US, and has a very similar infra government structure based upon the continued growth of economic stabile. Thus, both countries share history and are united in their common growth

Ancient Greek culture is best known for influencing the world in several areas. Which is NOT one of those areas? *

1. Buddhism

2. architecture

3. science

4. philosophy

Answers

Yea i think its 3 too because in science i never heard them talk about Ancient Greece

Why did it take an entire day for the Bolsheviks to capture the Winter Palace?

Answers

Answer: It was the most protected in Petrograd

Explanation:

During the October Revolution, the Bolsheviks/ Communists took over the government of Russia from a provisional government that had been put up after the Tsar abdicated.

They started by taking over multiple government buildings in the capital of Petrograd. The government responded by taking refuge in the Winter Palace and reinforcing it with various guards and military students. This forced the Bolsheviks to take it by force after a day.

On June 25, 1950, the United States united North Korea and South Korea.


Please select the best answer from the choices provided

T
F

Answers

Answer:

FALSE

Explanation:

On June 25, 1950, North Korea invaded South Korea, which was the beginning of the Korean War. For the next three years, the two countries fought bloody battles, North Korea with the help of China, South Korea aided by the United States heading a United Nations force with more than 10 other countries. As the war progressed, the border between the two Koreas moved back and forth, so to speak, depending on which side was winning at the time. When the war ended, the border practically went back to its original location.

what problem did the paramedic encounter at the accident​

Answers

Answer:

he couldn't save everyone

Explanation:

it say's it right in the story

True or false.More battles of the Revolutionary War took place in New York than in any other colony.

Answers

Answer:

True

Explanation:

What Russian president tried to reform and improve Russia’s economy by moving toward a democratic government

Answers

Answer:

Vladimir Putin, he did those things

Other Questions
Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2 What turns the drive shaft of the generator?Help Sophie has a doll collection with 36 dolls. She decides to sell s dolls to a museum and has r dolls remaining.What is the independent variable? The diffusion of gas inside the lungs is dependent on two liquids: water and surfactant. Without the surfactant lining the inner surface of the alveoli, what would most likely happen? (2 points)Air would not reach the bronchioles.Air would be trapped in the bronchioles.The lungs would over inflate.The lungs would lack the pressure needed to inflate. 8 yd6 yd15 yd10 ydAnswer:please help!:) After George learned that Mrs. Min suffered from schizophrenia, he mistakenly concluded that her tendencies to laugh easily and smile frequently were symptoms of her disorder. This best illustrates the: unreliability of the DSM-V unreliability of the DSM-V shortcomings of the medical model shortcomings of the medical model biasing power of diagnostic labels biasing power of diagnostic labels dangers of the biopsychosocial approach dangers of the biopsychosocial approach Which adaptations suit a beaver?