Please select the word from the list that best fits the definition

If the information is correct

Answers

Answer 1

Correct Question

Please select the word from the list that best fits the definition  

If the information is correct

a. objectivity

b. accuracy

c. authority

d. content

e. currency

Answer:

Answer is b. Accuracy

Explanation:

Accuracy means that any content / information is accurate and correct. all other words have different meanings.

Content means some material , currency means the money, authority means to have control or responsibility, objectivity means the quality of being objective.

Answer 2

Answer: B. Accuracy

Explanation: On Edge!!!!!


Related Questions

What is an installation?
A. An outdoor performance given by artists working with various
media
B. A movement performance in which poetry is recited live rather
than written or printed
O C. A compilation of written works that are gathered and then
published on a literary website
O D. An artistic work that alters the way viewers experience the space
in which the work is located

Answers

Answer:

The answer is D. An artistic work that alters the way viewers experience the space in which the work is located.

Answer:

D

Explanation:

Brain pop voting rights movie quiz

In which of these periods were the most black Americans elected to office?

A.During the American
revolution

B. Right before the civil war

C. Following the civil war

D. During the Jim Crow era.

Answers

Answer:D

Explanation:

During the Jim Crow era is the periods that were the black Americans elected to office. Hence, option D is correct.

What is Jim Crow era?

The Comte contended in Louisiana Court that the Act broke the Thirteenth and Fourteenth amendments because it did not treat white people and African Americans equally under the law. The Louisiana state was given the power to regulate railroad companies operating inside its boundaries.

The "separate but equal" argument provided constitutional justification for racial segregation legislation by establishing separate and equal public facilities and services for African Americans and whites.

Court rulings and regulations passed during the Civil Rights Movement ended de jure segregation, which was separation that was mandated by law and upheld by the government.

Thus,  option D is correct.

For more information about Jim Crow era, click here:

https://brainly.com/question/19550705

#SPJ2

What is the meaning of Folklore?
no copy pasting please or I'll report.​

Answers

Folklore is the traditional beliefs and customs. It is also the stories of a community, which is passed through the generations by the word of mouth.

Question ↷What is the meaning of Folklore?Answer↷The ancestral credence ,rituals , and folks of a specific crowd,passed down by the wordings of the forerunnersAn album by Nils Sjoberg for which she got her 11th grammy .A faithless sister to ,'Evermore'.

"I'm still a believer but I don't know why

I've never been a natural

All I do is try, try, try"

ㅤㅤㅤㅤㅤㅤ- Mirrorball (folklore)

Paul __________ tennis in the park last week. (play)
had played
is playing
has played
was playng
me pueden ayudar porfavor​

Answers

Answer:

had played

Explanation:

Answer: "had played."

Explanation:

Since this sentece is in past tense, the past tense version of the word "play" must be used.

why did mark feel pain when the doctor pressed his belly

Answers

left abdominal pain ??

Answer:

Stomach ache or could of been a broken bone bruised

Explanation:

He will feel pain because he can have a broken bone or stomach ache

What is the liturgy?

Answers

Answer:

Liturgy is the customary public worship performed by a religious group. As a religious phenomenon, liturgy represents a communal response to and participation in the sacred through activities reflecting praise, thanksgiving, remembrance, supplication or repentance.

Newsela - story "All-Black towns across America: Life was hard but full of promise"

Why does the author include the opinions of Norman L. Crockett and Susan Pearl?

A
to present the perspectives of experts who specialized in the history of the all-Black town Nicodemus
B
to present competing perspectives about when the all-Black town idea reached its height
C
to highlight the perspectives of settlers who moved to all-Black communities after the Civil War
D
to highlight the perspectives of experts regarding the period when all-Black towns proliferated

Answers

The author includes the opinions of Norman L. Crockett and Susan Pearl in the article "All-Black Towns across America: Life was Hard but full of Promise" for the purpose of option A. presenting the perspectives of experts who specialized in the history of the all-Black town Nicodemus.

Norman L. Crockett and Susan Pearl are cited in the article as experts on the topic of all-Black towns, particularly focusing on the town of Nicodemus. By including their opinions, the author strengthens the credibility and authority of the information presented in the article. The inclusion of these expert perspectives serves to provide valuable insights and expertise on the history, challenges, and promise of all-Black towns.

It allows readers to gain a deeper understanding of the specific context and experiences of Nicodemus and its significance within the broader narrative of all-Black towns in America. By featuring the perspectives of experts like Norman L. Crockett and Susan Pearl, the author enhances the article's overall informative nature.

Readers can trust that the information is well-researched and backed by knowledgeable individuals who have dedicated their expertise to the study of all-Black towns. This inclusion adds depth and richness to the article, allowing readers to engage with different perspectives and gain a more comprehensive understanding of the subject matter. Therefore, the correct answer is option A.

know more about knowledgeable here:

https://brainly.com/question/31253348

#SPJ11

eveloping and improving communication skills will help ensure that messages are sent and received properly. Please select the best answer from the choices provided. T F

Answers

The answer would be f because

An office space where all types of independent workers can rent a desk or office by the hour, day, or month is called what type of space?

A. freelance

B. writer’s

C. co-working

D. gig economy

Answers

C. Co-working
(Not 100% sure, but according to it’s definition, I assume the answer is C)

Today was day three of picketing Harley's Fine Fashions, Still no
progress, though the management refuses to take down the furs
from the main window display, Chet and Angelo made some great new
signs for the protest. One sign says, "The only thing we have to fear is
fur itself. I thought that was pretty clever. The most important thing
that happened today was that the local news came by. They
Interviewed me, and I told them we were there to help protect
defenseless animals and why we felt that was important. They said if
they decide to air the story, it would likely be aired tomorrow, but only if
it's a slow news day. I hope it does air - the more exposure a cause
gets, the better
Which event would be important enough for the author to update the post?
A. A Hollywood celebrity gives a speech about animal rights.
B. One of the protesters wears a shirt with a clever saying on it.
C. Harley's Fine Fashions agrees to take down its fur displays,
D. The plaketers were given free coffee from a local shop after their
protest

Answers

Answer:

C- Harley’s Fine Fashions agrees to take down its fur displays.

Explanation:

A p 3 x

What did Haymitch say was their first act of rebellion

Answers

Answer:

Hand holding

Explanation:

Credits to: jeopardylabs.com › play › hunger-games595

Help
Me which is what essay?

Answers

Answer:

Here are the matching phrase, pay attention to the  signal word that bold...

Explanation:

-Sara studies the reason for discarding the painting at that time->  problem and solution essay.  

-The team decided to challenge the call so that they might still be able to make the playoffs.-->cause and effect  essay.

-Finding the watering hole was the most important part of the expedition studying the animals’ habitat:-> descriptive essay.

-There is an assumption that democracy is falling in Eastern Europe. On the contrary, it’s  far healthier there than in parts of western Europe. -> compare and contrast essay.  

I hope it help..give me the brainliest.

what food does harold not realize lena don't eat

Answers

Answer:

Ice cream

Explanation:

hope this helps

Answer:

The answer is Ice cream

(1)The young widow Mary Pickersgill and her daughter, Caroline, moved to the corner house at Albemarle and Queen (now Pratt) streets in the heart of Old Town, Baltimore, Maryland, in 1807. Like her mother before her, Pickersgill had decided to make her living in the flag-making business. In a major port city like Baltimore, a hardworking maker of flags would be in great demand.

(2)Pickersgill's most famous commission came in 1813, during the second year of the War of 1812, often referred to as the "second war of independence." Baltimore was defended by a brick star-shaped fort named Fort McHenry. The commandant of the fort was Major George Armistead. He decided to have a gigantic battle flag made to rally his troops. In a report to General Samuel Smith, the commander of the defense of Baltimore, Armistead wrote, "We are ready [for the expected British attack] except that we have no suitable ensign to display over the Star Fort, and it is my desire to have a flag so large that the British will have no difficulty in seeing it from a distance."

(3)Pickersgill was selected by Commodore Joshua Barney, the commander of the American flotilla (small fleet) in the Chesapeake Bay, and General John Stricker (both important strategists during the War of 1812) to make the enormous garrison flag as well as a storm flag (for use in poor weather and possibly during battles). The flag that she designed and sewed by hand had fifteen stars and fifteen stripes, to represent the fifteen states in the Union in 1813. Pickersgill sewed five-pointed white stars measuring two feet from point to point on a blue field in the upper left-hand corner of the flag. The stars were arranged in five lines of three stars each.

(4)Ironically, in a war in which the American flag stood as a symbol of defiance against Britain, four hundred yards of wool bunting imported from England (before the blockade of Baltimore's port) were used to make the flag. The fabric was manufactured in eighteen-inch bolts. To complete the twenty-four-inch-wide stripes needed for the flag, Mary hand-sewed six-inch strips to each eighteen-inch piece of fabric. So much hand-sewing was involved in making this giant flag, along with the eighteen-by-twenty-five-foot storm flag, that about six weeks was needed to complete the commission.

(5)A letter written by Caroline Pickersgill describes how her mother often worked until midnight to complete the flags on time. Caroline helped her mother with the sewing, as did her cousins Eliza, Margaret, and Jane Young. Mary Pickersgill's mother also may have helped.

(6)When the flag was done, it measured thirty feet hoist (vertical measurement) by forty-two feet fly (horizontal measurement). Major Armistead's signed receipt for the two flags is preserved today at the Star-Spangled Banner Flag House and 1812 Museum in Baltimore. The receipt shows that Mary was paid $405.90 for the giant Star-Spangled Banner and $168.54 for the storm flag.

(7)Today the flag that inspired Francis Scott Key to write his poem during the Battle of Baltimore is on display at the Smithsonian's National Museum of American History in Washington, D.C. The flag had been an heirloom of the Armistead family until it was given to the Smithsonian in 1912. Expert seamstresses worked for weeks to conserve the Star-Spangled Banner by hand-stitching it to a backing of fine Irish linen. A curtain protecting the flag from light and dust was added in 1982.

(8)The Star-Spangled Banner was so large that Mary Pickersgill finished it at Brown's Brewery, a block away from her home. To understand how big the flag is, use string to create a rectangle measuring forty-two feet by thirty feet in your yard or in a playground.

The Early Life of Mary Young Pickersgill
(9)Mary Young was born on February 12, 1776, in Philadelphia. Her father, William Young, died when she was barely two years old. Her mother, Rebecca Flower Young, had made the Continental Colors flag that George Washington raised over his headquarters in Cambridge, Massachusetts, on January 1, 1776. During the Revolution, Rebecca made flags to help support her family, first in Philadelphia and then in Baltimore. Her advertisement in the Philadelphia Advertiser in 1780 and the Pennsylvania Packet in 1781 reads, "Colours for the Army and Navy made and sold on the most reasonable terms By Rebecca Young."

(10)When Mary was nineteen, she married John Pickersgill. The Pickersgills had four children, but only their daughter Caroline survived past infancy. John accepted a position as a claims agent in England, where he died on June 14, 1805. Mary and Caroline moved to Baltimore and became involved in the flag-making business.
Select all that apply.

One way to make the overall message of this article more objective would be to _____.

remove the quality statements
make more quality statments
add alternative opinions
remove any inaccurate information
none of the above

Answers

The orveeql answer is the one beside 3 when Gabriel did do it to Jessica in the story.



Which two words have the same vowel sound.
Choose two correct answers.
a. straw
b. clothes
c. brought
d. laughs
e. guess

Answers

Answer:

straw

brought

Explanation:

Straw and brought have the same vowel sound

a)
For the last 200 million years the amount of carbon dioxide in the atmosphere has
remained almost the same.
Describe the natural processes which remove carbon dioxide from the atmosphere.
To gain full marks in this question you should write your ideas in good English,
Put them into a sensible order and use the correct scientific words.​

Answers

Finally, carbon dioxide can also be removed from the atmosphere through the process of geologic sequestration. This is a process by which carbon dioxide is taken from the atmosphere and stored in underground reservoirs, such as oil and gas fields.

What is Atmosphere ?

Atmosphere is an environment consisting of a layer of gases surrounding the earth. It is composed of nitrogen (78%), oxygen (21%), argon (0.93%), and other gases in trace amounts. The atmosphere also contains water vapor, particulate matter, and dust. Atmosphere serves as a protective blanket for the earth, absorbing ultraviolet radiation, trapping heat, and helping to regulate the temperature of the planet. It also helps to protect us from meteorites and other celestial objects. The atmosphere also provides us with oxygen and other elements essential for life.

Carbon dioxide (CO2) is removed from the atmosphere through a variety of natural processes. The most important of these are photosynthesis, respiration, and ocean exchange.

Photosynthesis is the process by which plants use energy from the sun and carbon dioxide from the atmosphere to produce carbohydrates and oxygen. The carbon from the CO2 is stored in the plant’s tissue, while oxygen is released into the atmosphere. This process removes carbon dioxide from the atmosphere and helps maintain the balance of gases in the air.

Respiration is the process by which organisms use oxygen and release carbon dioxide as a by-product. This process is the opposite of photosynthesis and adds carbon dioxide back into the atmosphere.

Carbon dioxide can also be removed from the atmosphere through ocean exchange. The ocean takes in carbon dioxide from the atmosphere and stores it in its depths. The carbon dioxide is then converted into various forms, such as bicarbonate, which are then stored in the ocean.

To learn more about Atmosphere

https://brainly.com/question/24925283

#SPJ1

Whats the falling action in haji murad short story

Answers

Answer:

what is the story,,,please post the story,,,,

Explanation:

What’s the story ? you could try searching it up on shmoop or spark notes

Spring and Fall
To a Young Child
by Gerard Manley Hopkins

Márgarét, áre you gríeving
Over Goldengrove unleaving?
Leáves like the things of man, you
With your fresh thoughts care for, can you?
Ah! ás the heart grows older
It will come to such sights colder
By and by, nor spare a sigh
Though worlds of wanwood leafmeal lie;
And yet you wíll weep and know why.
Now no matter, child, the name:
Sórrow’s spríngs áre the same.
Nor mouth had, no nor mind, expressed
What heart heard of, ghost guessed:
It ís the blight man was born for,
It is Margaret you mourn for.

What do the falling leaves represent in "Spring and Fall"?

the sadness felt by young people

the heart that grows colder as years go by

the process of learning and growing

the inevitability of aging and death

Answers

Answer:

the inevitability of aging and death

Which organization limited the amount of weapons created for war in Europe?
A.
the European Coal and Steel Community
B.
the European Economic Community
C.
the European Agriculture Community
D.
the European Political and Religious Community

Answers

Answer:

A. The European Coal And Steel Community

Explanation:

A.

the European Coal and Steel Community

Explanation:

The first state was the creation of the European coal and steel community. One of the causes of the war was this very rich coal deposit that France and Germany were fighting over. So they decided that they would manage these resources, the coal and steel production, together. And they would also limit the creation of weapons of war. This cooperation is going to expand in 1957 with the  European economic community, which creates a common market.

why did the author include details about the cooking show he saw

Answers

Answer:

Well it depends on what the article was exactly about.  But the author might´ve included details about the cooking show because he probably wanted to included more facts and evidence. Also he may have wanted to persuade others to watch the show.

Explanation:

(Many authors may do this.)

Which statement best explains why this text is realistic fiction?

The story involves a conflict between faith and fitting in.
The narrator tells the story from the first-person point of view.
The narrator describes personal feelings about her faith.
The dialogue reveals the narrator’s true feelings about life.

Answers

Answer:

A: The story involves a conflict between faith and fitting in.

Explanation:

The dialogue reveals the narrator’s true feelings about life. hence the correct option is D.

What is realistic fiction ?

Realistic fiction is a genre of fiction writing that is grounded in real life situations and events.

This type of fiction is characterized by a portrayal of characters and events that are relatable and believable to the reader.

Realistic fiction often depicts the struggles and triumphs of ordinary people in everyday life. The genre typically includes settings that are familiar to readers, such as homes, schools, and workplaces.

While the stories may be fictional, they often touch on important themes and issues, such as social justice, human relationships, and personal growth.

Realistic fiction is a popular genre because it allows readers to see themselves and their own experiences reflected in the characters and situations presented in the story.

Learn more about realistic fiction here:

brainly.com/question/29587655

#SPJ7

Very simple

I will mark brainliest.

Please help ;-;

Answers

Answer:

what do you need help with?

Explanation:

Put the correct question tag
1. The lady sings quite nicely.. into question tags​

Answers

Answer:

The lady sings quite nicely, doesn't she?

Explanation:

This is an example of a question tag because it repeats the same question that it asks at the beginning of the sentence as it does at the end.

What do the stage directions best tell the reader about Woman One’s tone of voice and actions?

She is frightened and implies that Charlie may be involved.
She is angry and threatens Charlie into revealing the truth.
She is curious and questions Charlie to uncover answers.
She is amused and attempts to joke around with Charlie.

Answers

Answer:

Explanation:

She is curious and questions Charlie to uncover answers.

Answer:

A-She is frightened and implies that Charlie may be involved.

Explanation:

Guy on top is wrong, sorry for y'all getting it wrong from him.

If i'm wrong than I am sorry

What literally device does the speaker use in the phrase fragrant memories of the vanished flowers?

Answers

Answer:

The speaker describes the fragrant memories of the vanished flowers. The speaker speaks to a reader one hundred years in the future. ... Read Tagore's poem and analyze the use of apostrophe. Draw a conclusion and write two or three sentences about the overall effect that apostrophe has on the reader.

Explanation:

Hope it helps! Correct me if I am wrong :>

Im sure about my answer!

If you dont mind can you please mark me as brainlest?

Its ok if not :)

Personification

Metaphor

Imagery

A narrative poem

Answer: imagery

How do social networks create cliques online?

A.) They connect you with people who have similar opinions.

B.) They connect you with people you already know and like.

C.) They expose you to people with different views and new ideas.

D.) They encourage you to block people you don’t know or like.

Answers

B. They connect you with people you already know and like

They connect you with people you already know and like. Therefore option B is correct.

What is cliques?

In the social sciences, a clique is a collection of people who engage with one another and have common interests. Clique interaction is a normal element of social development for everyone, regardless of popularity, race, or gender.

The most typical method for creating cliques is via having shared interests. People may find themselves gravitating toward or becoming drawn to others who share their passion as they interact with one another while engaging in the basic activities they enjoy.

Cliques can undermine one's sense of self and make it more difficult for your youngster to comprehend their likes and dislikes. They might discover that they simply follow the crowd instead. The increased pressure to fit in may cause them to even struggle with moral choices.

To read more about cliques, refer to - https://brainly.com/question/12700848

#SPJ2

Read the excerpt from "Why Alligator Hates Dog.”

Alligator hissed in delight. "Well, look who’s here . . . the mangy, miserable mutt who’s been mocking me every night, shouting, ‘Come and get me, come and get me!’ I gotcha now, don’t I? Get ready, because I’m gonna snap you up and grind you into mincemeat!”
Based on the clues in the excerpt, what does gotcha mean?
A. have caught you
B. have admired you
C. have released you
D. have despised you

Answers

Answer: A. Caught you

Explanation: When reading the excerpt you can see the alligator is annoyed and angry the dog continuously teased him. The dog would say "cone and get me" Meaning he wanted the alligator to chase him. When the alligator finally catches him he threatens to grind him into mince meat.

Answer:-A- have caught you

HAVE CAUGHT YOU -A

is the answer

have a good day :D

PLEASEEEE HELLLLLPPP Use the drop-down menus to answer the questions.

What does Paul say likely motivates him to let Mitchell

ride Ghost Wind?

Is Paul's motivation intrinsic or extrinsic?

I looked down at Mitchell and stopped, knowing that

despite our understanding, he was itching for a fight with

me. Now, I don't know what possessed me in that

moment to say the next thing I did. Maybe I was feeling

guilty that because I was my daddy's son, I could ride

Ghost Wind. Maybe it was that, but it wasn't out of fear I

said what I said. I no longer was afraid of Mitchell. "You

want to ride him?" I asked.

Mitchell took a step backward. It was obvious he hadn't

expected me to say that. "You know I can't ride him," he

said. "Your white daddy'd kill me."

"You want to ride him?" I asked again.

Mitchell looked at the stallion, then at me. "So, what if I

do?"

Answers

Answer:

a

Explanation:

i think :)

Answer:

It is A, I got it correct on my Unit Exam Review

Explanation:

To establish relationships among ideas in argumentative writing, an author should create organization among:
A. claims and counterclaims
B. reasons and evidence
C. style and tone
D. Both a. and b.

Answers

It’s D both a and b :)! Hope this helps

Writing prompt: Write an argumentative essay for or against maintaining traditional coming-of-age ceremonies, such as a bar mitzvah or a quinceañera.

So, I have to write an essay on this, but i don't know what i should write about. Can someone give me examples and some things about it? I would appreciate it, thank you!

Answers

I think you should be for maintaining traditional coming- of- age ceremonies because coming from me i am jewish and i had a bat mizvah and i think it’s important to have one because it’s apart of a tradition in the jewish world and it is a good thing to learn about your religion in a deeper way.
Other Questions
PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2 What turns the drive shaft of the generator?Help Sophie has a doll collection with 36 dolls. She decides to sell s dolls to a museum and has r dolls remaining.What is the independent variable? The diffusion of gas inside the lungs is dependent on two liquids: water and surfactant. Without the surfactant lining the inner surface of the alveoli, what would most likely happen? (2 points)Air would not reach the bronchioles.Air would be trapped in the bronchioles.The lungs would over inflate.The lungs would lack the pressure needed to inflate. 8 yd6 yd15 yd10 ydAnswer:please help!:)