PLEASE HELP WILL MARK BRAINLIEST

PLEASE HELP WILL MARK BRAINLIEST

Answers

Answer 1
Cause and effect…………

Related Questions

How do the pigs’ points of view differ from the other animals’ points of view on Sugarcandy Mountain? Select the correct answer below. A. The pigs believe that the Rebellion will be like Sugarcandy Mountain, but some of the other animals believe the Rebellion will not be like Sugarcandy Mountain. B. The pigs do not believe in Sugarcandy Mountain, but some of the other animals believe in Sugarcandy Mountain. C. The pigs believe in Sugarcandy Mountain, but some of the other animals do not believe in it. D. The pigs believe that the Rebellion will not be like Sugarcandy Mountain, but some of the other animals believe the Rebellion will be like Sugarcandy Mountain.

Answers

Answer:

B. The pigs do not believe in Sugarcandy Mountain, but some of the other animals believe in Sugarcandy Mountain.

Explanation:

This question is about "Animal Farm" which is a fable that shows a moment when animals on a farm decided to rebel against humans and no longer be controlled by them.

In this story, we know a raven called Moses who tells stories about a place called Sugarcandy Mountain, which is the place where animals go when they die. According to Moses, in this place there is only happiness and sugar grows in hedges. Some animals are delighted with this place and believe that it is real, but the pigs do not believe it and try at all costs to convince the animals not to believe Moses. For pigs, rebellion against humans is the only scenario that can bring happiness to animals.

Which prompt would be best addressed with a compare-and-contrast
structure?
A. Research the life of British prime minister Winston Churchill.
Include information about his birth and early life, education, family,
and career.
B. How were the ancient Inca and Aztec cultures similar? How did
they differ? Consider factors like size, location, language, religion,
and culture.
C. Rhinoceros populations are now on the verge of extinction. What
factors led to this terrible situation? What steps can be taken to
protect the remaining rhinoceroses?
D. In the ancient world, Rome was the center of a powerful empire.
However, it gradually lost its strength, and in 410 CE it was invaded
and practically destroyed. What factors contributed to Rome's
downfall? Why did it find itself unable to defend its own walls?

Answers

Answer:

B - How were the ancient Inca and Aztec cultures similar? How did they differ? Consider factors like size, location, language, religion, and culture.

Explanation:

Compare and contrast means to note what is similar and different about two or more things.

Answer:

A

Explanation:

For ape.x

1. Answer the question “Who Am I?” in at least 10 different ways. How many of your responses fall into each of the four categories outlined in paragraph 6? Which of your responses do you consider most important to your self-image?

Answers

Answer:

We have the same packets, would you mind sharing your answer with me?

Explanation:

The author makes several references to goldilocks throughout the article. To whom or what does the author compare to Goldilocks? How do these comparisons contribute to the development of the article as a whole? Write an essay of three to four paragraphs to explain your answer. (Look up the passage its called " "Goldilocks" and Life on Other Planets: Just Right or a Lot of Hype?"

Answers

Answer:

The Goldilocks principle is named by analogy to the children's story "The Three Bears", in which a young girl named Goldilocks tastes three different bowls of porridge and finds she prefers porridge that is neither too hot nor too cold, but has just the right temperature.

The Goldilocks principle is named after the children's story "The Three Bears," in which a young girl named Goldilocks tastes three different bowls of oatmeal and discovers that she likes oatmeal that is not too hot nor too cold, but only totally correct.

Why being in the Goldilocks Zone allows life on planet Earth?

The Earth's orbit is more than the sun than that of Venus but closer than that of Mars. In all other words, Earth's orbit is within the Goldilocks Zone of the sun. This explains how Earth can sustain a vast ocean of liquid water.

The Goldilocks Zone is the habitable zone surrounding a star in which the temperature is just right for liquid water to exist on a planet. Water is necessary for life as we understand it.

Thus, The Goldilocks principle is named after the children's story "The Three Bears," in which a young girl named Goldilocks tastes three different bowls of oatmeal.

To learn more about Goldilocks Zone, follow the link;

https://brainly.com/question/12833847

#SPJ2

hey can you help me to a dialog with the words assist,assistance,assistant

Answers

Answer:

If what I am about to say is not what you meant, I am sorry.

"Hey can you become my assistant so that you can assist me in my line of work?" "Your assistance will be well appreciated"

narative writing: tells a story has characters,
setting, sequence, beginning, middlw and end,
Help me please

Answers

Answer:

There were once four seasons in the year called Spring, Summer, Autumn and Winter. They would always come at a random time of the year, they wouldn't come at a certain time so it would cause problems between them.

All the seasons wanted to solve this problem so they came together and came up an order  of when they should come. But, Summer and Winter didn't like this idea. So, instead of sticking to their order Summer and Winter would purposely clash and create problems. One day it would be hot the other it was cold, sometimes both. They never wanted to come to a resolution all they did was fight.

Spring and Autumn had enough and held a meeting. They told the seasons that they couldn't do this anymore because they were causing problems. Winter and Summer realized what they had done and regretted it. They couldn't see past their pride and apologized to each other. They finally decided to do what Spring and Autumn had originally come up with.

Spring came after Winter, and with her the trees and fields begin to flower and it stops being so cold. And Autumn, who follows Summer, brings with him the falling leaves, the start of the cold weather and a few rain showers. Because of this the seasons came up with a new one to celebrate. This new season was a mix of all of them. This season would come with flowers, rain shower, and nice breezy sometimes cold weather. The seasons loved this because it meant they could celebrate with each other.  

Which of the following quotes from Catching Fire uses an ex-
ample of direct characterization?

Answers

Answer:

The answer is C

Explanation:

Direct characterization is when a character is being described in a straight forward manner which in this case the old woman is being described in a straight forward manner.

How do diction and syntax impact the meaning of the passage? Use this list of words to describe diction, if needed.

Answers

Quien sabe nunca pongo atención

Answer:

Answer:The author uses playful, yet formal diction to show that slacking, or taking a break from busy activities, is important to success. The author encourages the reader to “embrace the joy of doing less” and uses a tone of admiration when describing the values of Montaigne, Thoreau, and Whitman.

By placing words such as retired and lazy in scare quotes, the author draws attention to the idea that what some consider lazy is actually a wise choice. The mood for the reader is peaceful, yet reflective. The author calls into question the common notion of slacking by using parallel structure for two contrasting ideas, stating, “Thoreau used time away from traditional work not to escape life but to embrace it.”

Explanation:

5. How does this
example help
the writer make
his point?​

Answers

Answer: They Use Appropriate Sentence Length, Avoid Filler Words, Be Precise with Your Words, Use the Best Voice For the Situation.

Explanation:

need help
I WILL GIVE BRAINLIEST!!!!!

Answers

Answer:

A dream holiday:

My Amazing New Year

Explanation:

I went to Mexico, the place i was born in and stayed at my grandmas house, we spent there about 3 or 4 weeks, i was with all my cousins, the weather was cold but nice and calm, we ate posole, we played board games and threw fireworks, i liked that i as with my whole family that vacation

Answer:

I went to Colorado one year

Sit means to __________________.
Set means to ___________________.

Answers

Sit means to be seated.
Set means to place something somewhere.

Explanation:

sit means to be seated

set means to put things in place

Forward and chapter 1-4
Book:shattered by Eric Walters

Answers

Answer:

can u pls send the full story?

they have been learning Russian _____ their childhood.
a. for b. since c. still d. during​

Answers

Answer:

B. since

Explanation:

Answer:

d. during

they have been learning Russian during their childhood (i think this makes the most sense)

Writing a personal letter
-200 words

Answers

hey! what’s topic one :)

In "It's Complicated: The Social Lives of Networked Teens. Most teens are not compelled by gadgetry as such—they are compelled by ____


A- Parents

B- Friendship

C- Adults

Answers

Answer:

................friendship

The answer is B friendship

Write a short paragraph explaining how the theme developed in your story. i read freak the mighty

Answers

Explanation:

follow me plzz

btw the answer is none because there is no a story

Can somebody help me please?

Answers

Answer:

Classical is usually depicting well known objects, people, or places. It usually has a main subject. Abstract does not have a main subject, as it is to be interpreted by the viewer.  

Explanation:

Similarities and differences of a sound of thunder and “button button”

Answers

Answer: ?

Explanation:

When things decompose they
O break down.
o change color.
o change size.
O store energy.

Answers

Answer:

Explanation:

Option A break down is the correct answer

The answer is Break down.

1. What does it mean to follow the philosophy of non-violent social change?

2. What are the similarities and differences the between the civil rights leaders: Gandhi, Martin Luther King Jr. and Cesar Chavez?

3. What is "The Letter from Birmingham Jail"? What are the tenets of MLK's philosophy of violence?

Answers

Answer:

1. Thus, for example, Tolstoyan and Gandhism non violence is both a philosophy and strategy for social change that rejects the use of violence, but at the same time it sees nonviolent action (also called civil resistance) as an alternative to passive acceptance of oppression or armed struggle against it.

2. Martin Luther King, Jr. led a nonviolent civil rights movement in the South. ... Chávez led a nonviolent movement in California that worked to better the lives of people in demanding civil rights and social and economic justice.

3. We Should Resist Injustice Everywhere with Non-Violent Disobedience. In "Letter from Birmingham Jail," Dr. King says that we're all responsible for justice across the nation—and around the world. Justice isn't defined or contained by mere laws.

Explanation:

Which character do you feel is the most sympathetic towards Minnie Wright? Explain your answer using evidence from the text of the play.

Answers

:Mrs. Hale is the most sympathetic to Minnie Wright because she knows about Minnie's unhappy marriage to Mr. Wright. Her sympathy is also driven by her own guilt over not visiting Minnie, despite being her neighbor. Her sympathy is also evident when Mrs. Hale asks Mrs. Peters to lie to Minnie about her preserves:

MRS HALE: I might have known she needed help! I know how things can be—for women. I tell you, it's queer, Mrs Peters. We live close together and we live far apart. We all go through the same things—it's all just a different kind of the same thing, (brushes her eyes, noticing the bottle of fruit, reaches out for it) If I was you, I wouldn't tell her her fruit was gone. Tell her it ain't. Tell her it's all right. Take this in to prove it to her. She—she may never know whether it was broke or not.Explanation:

noel could not eat the pizza with the loose tooth. This is an example of

Answers

Answer:

This is an example of your adult teeth growing in, so your baby teeth can come out, and you will be able to eat harder food as you get older.

Explanation:

Read the excerpt from "The Players."

Whenever I spot them around school
with their horns, I think about
how silly it looks, and I think
they need someone to blow down
their too cool fronts, to show
them they aren't that different
from the rest of us who run,
throw, and jump in the hot
sun.

Which word best describes the tone of the excerpt?

A. angry
B. sad
C. grim
D. playful

Answers

Answer:

the answer is D because i just did the test and got 100% on it hope this helps

Explanation:

The word that best describes the tone of the excerpt is angry. Option (a) is correct.

What do you mean by Excerpt?

The excerpt is a short part taken from a speech, book, film, etc. In writing, an excerpt is a passage that is quoted from a larger work, like a book, poem, or article.

The way an author conveys their attitude through their writing in an excerpt is how tone in literature is defined. The tone can fluctuate drastically, or it can stay consistent the entire time. The way you employ syntax, your point of view, your diction, and the formality of your writing all convey tone.

Examining words with positive or negative meanings is the greatest technique to determine the tone of a piece in an excerpt.

Therefore, Option (a) is correct.

Learn more about Excerpt, here;

https://brainly.com/question/29708851

#SPJ6

Which summary best captures the central idea of "Sonnet 100”?

The speaker wants to spend more time with his beloved.
The speaker is mostly angry at his muse for disappearing.
The speaker hopes that his muse will help him write a new poem.
The speaker says that his only care in the world is youthful beauty.

Answers

Answer:

C: The speaker hopes that his muse will help him write a new poem.

Explanation:

Answer:

The speaker says that his only care in the world is youthful beauty.

Explanation:

Paulina is a helpful co-worker and a good friend____?

(A too

(B) two

(C) to

Answers

Answer:

A) too

Explanation:

The answer would be A since:

B is the number two. For example, "Can I have 2(two) pies please"

C is like giving something to someone. For example, " From (Y/n) to (Name)"

And finally A is like wanting to be included in something also (Just an example, not the actual definition) For example, "Can I go to the waterpark too?"

In conclusion, the answer would be A) too :)

Hope this helped

POINTSS

JUST KEEP SMILING :)

How are you ?

Answers

Answer:

I am having a great day and your day?

Explanation:

im kinda stressed im a senior and my deadline is in two weeks and i still have alot to do im not sure if ill be graduating on time

3. When Diego and his buddies accept a dare to stay in an old abandoned house, they knew that it would be scary, but they had no idea just how scary it would be. As his friends begin disappearing one by one, Diego learns that the house is not abandoned at all, but inhabited by a vampire. Diego no longer cares about spending the night in the house. All he cares about now is getting out alive. Will he escape or be a vampire's lunch?
Protagonist:
Antagonist:
Type of Conflict:

Answers

Answer:

In literature, any struggle between two or more

Answer:

Protagonist: Diego because he is the main character.

Antagonist: The Vampire.

Type of Conflict: The need to survive.

topic: the girl who couldn't see herself.

question: what did you learn while reading ​

Answers

Can toy post the article

a sportsman who uses an animal or a bike​

Answers

Answer:

and what is it you needed help with??

Explanation:

A sportsman uses a bike

Each moment apart takes a year till we reunite my dear.
Simile, metaphor, personification, or hyperbole

Answers

Answer:

Hyperbole

Explanation:

A hyperbole is a phrase that adds more emphasis/makes things seem more dramatic. So they aren't really apart for a year but the speaker is saying that even a moment away from the other person feels like a year.

Other Questions
In the formula =C5*$B$3, C5 is what type of cell reference?relativeabsolutemixedobscure Please help I will give brainliest can someone please help me with this! Which joint injury is the result of running on hard surfaces or uphill?whiplashrotational injury at shouldershin splintsoveruse of elbow The area of a right triangle is 12 cm2. Which of the following could be the lengths of the legs of the triangle?2 cm and 6 cm4 cm and 6 cm3 cm and 2 cm3 cm and 4 cm What is the value of X in the equation. X- 4.3 = 2.5 Why were Julius and Ethel Rosenberg convicted of treason?They were proven to be spying for the USSR.They tried to attack the US with nuclear weapons.They brought USSR secrets to the US government.They wanted to leave the US to go live in the USSR. Which of the following is a true statement? A. Disruptions in an ecosystem are normal and natural changes.B. Disruptions in an ecosystem are caused by both human activity and environmental disturbances. C. Ecosystems are complex, interactive systems that include both biotic and abiotic components of the environment. D. All of these are true statements. A cylindrical soup can has a radius of 1.1 in. and is 5.4 in. tall. Find the volume of the can and round to the nearest tenths if necessary PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth.