Explain how you knew this example was a simile, a metaphor, or personification's.
“In the Black Hills”

Answers

Answer 1
not a simile because it doesn’t use like or as, and not personification because it is not giving non-human things human characteristics, therefore it is a metaphor because it is referring to dark hills but they aren’t actually black.

Related Questions

Which statement BEST explains the effectiveness of this introduction paragraph?

Answers

I'm pretty sure it's B considering that the first couple of sentences do not fit the topic of the last sentence.

Question:

Which statement BEST explains the effectiveness of this introduction paragraph?

Answer:

I think for me it's B.

Explanation:

Because it only contains questions and doesn't provide enough information.

-HunnyPeachy

can yall help me with this

Answers

Im pretty sure it’s C
Sorry if I’m wrong but I also believe it’s C .

What message was the author of The Lorax trying to convey? Or, Choose a real-life example of whom or what you think The Lorax represents.

Answers

The Lorax is a creature who is described as the protector of the trees in a small town. The role of the Lorax suggests that the trees need protection from something threatening. The author wants to convey a serious message to readers about the environmental dangers of overdevelopment.

I guess to take care of the environment because if we cut the trees and keep damaging the environment around us, one day we will regret doing what we did and notice how environment is essential for a healthy living (I have no idea if what I just wrote is correct or not)

helppppppppppppppppp

Answers

Answer: C



Explanation:

What does the overlap of the two ovals show?

A. The first 2 multiples of 6.
B. The first 2 common multiples of 6 and 8.
C. The first 2 factors of 6 and 8.
D. The greatest common factor of 6 and 8.

Answers

A is the answer the first 2 multiplies of 6
A because it’s makes a lot more sense

The men arrive at Elephant Island. Do you think this is a victory or just another obstacle? Why? Write 2-3 sentences.

Answers

It’s another obstacle as now they begin having to start surviving by finding shelter away from the ocean as they are now stranded.

Why did Kesz become “an advocate of better health for street kids”?
Kesz became “an advocate of better health for street kids” because

Answers

Answer:

Kesz becam an advocate of better health for kids because  everyday homeless kids die from diseases and he felt sorrow for them. these diseases were linked to unsanitized environments, poor hygiene, and overall gross environment.  he felt for these kids because one day he was just like them and he wanted to give back.

Explanation:

Answer:

Kesz became an advocate of better health for Street Kids because he is giving hope throughout his community and letting people know that even though kids may live on the street and die because of it people can stand up for it and make a difference. He is stating a claim as to why there can be better health for street kids throughout his powerful article. His article and his thoughts that has came to be on this paper states how he became an advocate for these kids as he once was. He was in the shoes of kids on the street he knew how it was. So, therefore he is sharing his story hoping to help other kids around the world to deal with this problem this is how he is an advocate for these kids.

Explanation:

Plz Rate My answer & If you have any questions feel free to ask:)

Our neighborhood should organize a volunteer beach watch to protect sea turtles that come to shore to lay their eggs. Volunteers could redirect vehicles and people away from nesting sites. Because lights could prevent sea turtles from coming ashore, volunteers should ask everyone to avoid using flashlights and flash cameras. And fires, which also produce light, are a hazard for hatchlings, or baby sea turtles.

What is the clause in this argument, and which relationship does it help clarify?

A.
to protect sea turtles; it clarifies the relationship between the claim that there should be a neighborhood beach watch and the reason that sea turtles are in danger.
B.
are a hazard for hatchlings; it clarifies the relationship between the claim that lights are hazardous for baby sea turtles and the reason that lights prevent them from coming ashore.
C.
Our neighborhood should; it clarifies the relationship between the claim that there should be a neighborhood beach watch and the reason that sea turtles need protection.
D.
Because lights could prevent sea turtles from coming ashore; it clarifies the relationship between the claim that there should be a beach watch to help protect sea turtles and the reason that the watch volunteers should prevent too much light from being used.

Answers

Answer:

a

Explanation:

The answer should be A

Read and look at this graphic from Citizenship.

What central idea in Citizenship does this example support?

People should follow powerful leaders and do what they say.
Not everyone must vote, but all people should help their communities.
Marches are one way that people can make their views known.
People should participate in shaping their laws and government.

Answers

People should participate in shaping their laws and government

Not everyone must vote, but all people should help their communities.

Which detail from chapter 5 of The Outsiders, the chapter where Ponyboy and Johnny spend a week at the old church, should be included in a summary?
what they want to do
what the minor characters are doing
what they do every day
what they eat every day

Answers

Answer:

What they do every day.

Explanation:

1. I’ve read the book. 2. Nothing else is important in a summery.

What they do every day

which three details do authors mainly focus on while developing characters through indirect characterization?
A. Character Appearance
B. Character Achievements
C. Character Speech
D. Character Actions
E. Character Occupation

Answers

Answer:

B,D,A

Explanation:

B,D and A.  they focus on Character Appearances because they want people to know how the character looks.  They also want to show Character Achievements so people know what the character knows how to do.  Finally Character Actions because they want to show what character does or says.

The three details which authors mainly focus on while developing characters through indirect characterization are (A)Character Appearance, (C)Character Speech and (D)Character Actions.

What is Indirect Characterization?

Indirect characterisation is a way to describe the characters of a story/write-up through the traits they possess. It doesn't define the character directly.

Components of Indirect Characterization-

There are four components of Indirect Characterization-

SpeechActionsThoughtsAppearance

Therefore, the correct answers are (A), (C) and (D).

Learn more about Indirect Characterization on https://brainly.com/question/887965

#SPJ2

Go to this link and see the questions

https://notability.com/n/0VEui_AKpDsNqlETXnHfPH

This is actually for choir class so.

Answers

ANSWER: the answer is a

Answer:

A

Explanation:

7.4 Why has the author chosen to include the word applaud in paragraph 11 in the text, “Goodbye Bottled Water”?
A) To point out that San Francisco can do a better job recycling.
B) It is recognizing San Francisco efforts to recycle plastic bottles.
C) San Francisco can teach other cities how to recycle efficiently.
D) The International Bottled Water Association is a harsh critic of San Francisco’s recycling efforts.

Answers

Answer:

b

Explanation:

Draw Conclusions Who is “Moses” that is spoken of in paragraphs 1 and 2? What clues later in the story help you to identify “Moses?”

Answers

Answer:Ojala te sirva

Explanation:

Moisés (1391–1271 aC): un príncipe egipcio que se convirtió en el líder y profeta del pueblo judío, llevándolos de la esclavitud en Egipto a través del Mar Rojo hasta el Monte Sinaí. En el Monte Sinaí, Moisés recibió los Diez Mandamientos, que forman una base importante del Antiguo Testamento y la Torá. En ambas tradiciones, Moisés es el autor del Pentateuco, en hebreo Torá, los cinco primeros libros de la Biblia, que contienen la Ley, llamada por ello Ley de Moisés. ... En todas las religiones abrahámicas, Moisés es una figura central como profeta y legislador.

Answer:

"Moses" is revealed as Harriet Tubman

Explanation:

It revealed that Harriet was considered "Moses". It also reveals that she is the one known as Moses and as a figure of mystery to the masters of the slaves. The structure of the paragraph showed the masters' illogical reaction to Moses because they assumed she was a man and they did not believe that she existed. At first, they did not believe he existed but soon later they did and offered rewards for his capture.

In the Novel 'Monster', on page 87, Osvaldo Cruz says that he was afraid of Steve Harmon. Is there any reason why the reader (or the jury) shouldn’t believe him? Use evidence from the text to support your answer.

Answers

Answer:

I'll geuss we never know

*cues music*

Explanation:

In which word is the consonant h silent?



eyehook



lather



harried



onslaught

Answers

last one i’m pretty sure
Onslaught is your answer

What do the last three lines of the poem reveal about the narrator's perspective in the bookmaking a fist?
The narrator looks fondly upon that trip, despite her fear of death.
The narrator has accepted not knowing everything and by "clenching and opening" her hand, she reminds herself that she is alive.
The narrator is frustrated with all of the unanswered questions she still has.
The narrator has not grown up, but feels stuck in that car.

Answers

I have a feeling its C, the narrator is frustrated with all of the unanswered questions she still has!

The answer is:

The narrator has accepted not knowing everything and by "clenching and opening" her hand, she reminds herself that she is alive.

(Will give brainleist) Spring training is not...........

Answers

Answer:

the spring would not be so pleasant

Explanation:

Sorry if wrong

Answer:

I'm only answering so you can give the person who answered a brainliest and she/he is correct

Explanation:

50 POINTS PLS HURRY! Which describes simple, solid instruments that produce sound by being struck, scraped, or shaken?
a. aerophones
b. chordophones
c. idiophones
d. membranophones

Answers

Answer:

Idiophones

Explanation:

Answer:

Idiophones

Explanation:

"The Day is Done"
by Henry Wadsworth Longfellow

The day is done, and the darkness
Falls from the wings of Night,
As a feather is wafted downward
From an eagle in his flight.

5 I see the lights of the village
Gleam through the rain and the mist,
And a feeling of sadness comes o’er me
That my soul cannot resist:

A feeling of sadness and longing,
10 That is not akin1 to pain,
And resembles sorrow only
As the mist resembles the rain.

Come, read to me some poem,
Some simple and heartfelt lay2,
15 That shall soothe this restless feeling,
And banish the thoughts of the day.

Not from the grand old masters,
Not from the bards3 sublime,
Whose distant footsteps echo
20 Through the corridors of Time.

For, like the strains of martial4 music,
Their mighty thoughts suggest
Life’s endless toil and endeavor;
And to-night I long for rest.

25 Read from some humbler poet,
Whose songs gushed from his heart,
As showers from the clouds of summer,
Or tears from the eyelids start;

Who, through long days of labor,
30 And nights devoid of ease,
Still heard in his soul the music
Of wonderful melodies.


Such songs have power to quiet
The restless pulse of care,
35 And come like the benediction5
The follows after prayer.

Then read from the treasured volume
The poem of thy choice,
And lend to the rhyme of the poet
40 The beauty of thy voice.

And the night shall be filled with music,
And the cars, that infest the day,
Shall fold their tents...
And as silently steal away.


Which quotation best clarifies the reason for the speaker’s request to hear a “simple and heartfelt lay” in line 14?

A “Read from some humbler poet,
Whose songs gushed from his heart,” (lines 25-26)

B “Who, through long days of labor,, , And nights devoid of ease,” (lines 29-30)

C “Still heard in his soul the music
Of wonderful melodies.” (lines 31-32)

D “Such songs have power to quiet
The restless pulse of care,” (lines 33-34)

Answers

Such songs have power to quiet the restless pulse of care

PLEASE HELP AS SOON AS POSSIBLE. Pauline is curious about the benefits of year-round schooling. Which of the following research questions could Pauline use to find information about her topic?

A.

What do teachers think of the year-round schedule for students?

B.

How much money does year-round schooling cost school districts?

C.

In what ways does year-round schooling help with student achievement?

Answers

Answer:

c

Explanation:

sounds better i think

The answer is C :)!!!!

Who is telling the story In the book buried onions?

Answers

Answer:

Gary Soto

Explanation:

Answer:

It might be Eddie

Explanation:

Which of the following sentences contains a compound subject?

Answers

Answer:

I think it's A

The answer should be A.

Which sentence best describes how the camera captures Antony's emotions in the video Julius Caesar?


The camera focuses only on individual citizens who share Antony's grief.

The camera focuses on the crowd because they question Antony's sincerity.

It focuses on Antony's face as he speaks to emphasize his emotions.

It focuses on the body of Caesar to remind the viewer why Antony is upset.

Answers

Answer: C. It focuses on Antony’s face as he speaks to emphasize his emotions.

Explanation:

Answer:

C. It focuses on Antony’s face as he speaks to emphasize his emotions.

Explanation:

Across loyal constant or steadfast. -5 firmly fixed or balanced 7. without error or fault s. strength in a person's nature Down -2. able to be relied on as honest 3. firmly fixed not likely to give way 4. remaining the same 5. high respect or esteem​

Answers

Answer:

gzsxdhb

Explanation:

(a) Analyze What different types of details does Petry use to develop Tubman’s character? (b) Infer Describe Tubman’s character, based on these details.

Answers

Answer:what the text?

Explanation:

The answer would be B

A universal theme or idea ________________________________. Regardless of who we are or
where we come from, we can recognize and connect a universal theme or idea to our
own lives

Answers

Answer:

A universal theme is an idea that applies to anyone regardless of cultural differences, or geographic location.

The ____________kids were too rowdy in the house, so their mother took them to the park to play.

Answers

Boisterous, it means noisy, energetic, and cheerful and is a synonym of rowdy
Your answer would be Boisterous

GIVING BRAINLIEST!!!
Royston plays a video game 7 times. His scores are 60, 65, 66, 74, 69, 72, and 63. Which is the best measure of center of Royston's performance?

A. median

B. middle number

C. mean

D. mode

Answers

I think it’s median also I wouldn’t open that photo sounds a little sketchy
The answer is median

Which statement best implies the value that Mr. Cavor places on knowledge?

A.) “Even if they have no generous emotions, they will teach in order to learn…. And the things they must know!"

B.) "They don't understand us," he said, "they think we are merely strange animals”

C.)"I was angry at the time. But—it was perhaps necessary we should get on.”

D.)"Bedford," said Cavor, "it goes down. It keeps on going down."

Answers

Answer:

A is the answer i believe

Explanation:

Answer:

“Even if they have no generous emotions, they will teach in order to learn…. And the things they must know!"

Explanation:

Other Questions
how long will it take for a car at rest to accelerate at 7m/s^2 to a speed of 45 m/s What is the distance between (3, -2), (2, -4)? Brad found Middle C on the piano writerA) any note he wanted it to beB) to the left of the three black notes at the bottomC) to the left of the 2 black notes in the middleD) to the right of the 2 black notes in the middle Determine which equation has the same solutions as the given equation.x2 10x 11 = 0A. (x 10)2 = 36B. (x 5)2 = 36C. (x 5)2 = 21D. (x 10)2 = 21 if you subtract 17 from my number and multiply the difference by -6 the results is -138 what is Sarah's number Find the volume for the regular pyramid.6 cu. units12 cu. units4 cu. units What role does Janes ambiguous social position play in determining the conflict of her story? (its based on the book Jane eyre)I need this ASAP! DQuestion 2If a right triangle has side lengths 6, 6.7 and 3, which side is the hypotenuse?O 3O 6.7O 15.706 What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: