A painting titled Oh, Jeff by Roy Lichtenstein. A comic style woman's face with short hair holds a phone to her ear with a speech bubble that says "Oh, Jeff ellipsis I love you too ellipsis but ellipsis". What is the above image about?

Answers

Answer 1

Answer:

Answers may vary. A generic romance-comic story line in which two people fall in love.

Explanation:


Related Questions

Personal questions abt the SAT I wanna be prepared. pls, help.
how can I prepare for the SAT math and other test subjects?
how many times can I take it?
how early can and should I take it?
how important is the SAT?
how long does the SAT take?
is there anything specific I should know about the SAT

by the way, im 15 10th grade going into 11th

Answers

Answer:

Use Khan Academy, it is a great resource.

Explanation:

Khan Academy should be free to use to study for the SAT. It can also create study sessions custom to you and what you feel needs the most improvment in your education. If it isn't free, you can always talk to your school counselor to get an account for free. You can take the SAT as many times as you like, but you will most likely have to pay additional money for any extra tests outside of the one taken through the school. The SAT is pretty important for getting into more prestigeous schools. But don't worry and stress yourself out about it too much. A test score does not define your educational abilities. You can take the SAT your Junior year or any year after. The SAT usually takes about 3-4 four hours. You should always just try your best on the test, it's not a fun test to take. Also, pace yourself since you will be timed on all portions of the test.

Se uma peça de dança ou teatro envolvesse um monumento de sua cidade,quais histórias poderiam ser contadas? Que situações poderiam se tornar danças? Como seriam essas danças?

Answers

Answer:

como una obra de teatro.Si una pieza de teatro de danza involucrara un monumento en mi ciudad, probablemente sería sobre vacaciones o las situaciones podrían ser sobre cómo solucionarlo. Estos bailes se verían

(¿Lo respondí correctamente o de otra manera?)

(Mark brainlest please?)

This term describes the guidelines or requirements that are used to judge the overall effectiveness
of a work of art.

1)performance
2)presentation
3)criteria
4) interaction

Answers

Answer:

Criteria

Explanation:

The criteria is like rules of guidelines used to judge something. In this case a work of art.

SOUL MOVIE

1. What is the effect of Joe going to the audition?

2. What causes 22 to bring Joe to the Zone after the Hall of Everything?

Answers

Answer:

he got happy

Explanation:


Tony is reflecting on the baseball game that he just attended, wishing that he had remembered his camera. He recalls the final inning when his
favorite team was down by several runs, three batters were on base, and a mediocre hitter was at bat. After the pitch was thrown, the hitter hit a
huge home run bringing all the batters home and winning the game. Everyone was cheering and jumping up and down and hugging. If Tony had
remembered his camera, what specific moment should he have snapped a photo of if he wanted to capture the most critical point of the game?
A. the pitcher winding up to throw the ball
B.the batters on base waiting for the pitch
everyone jumping and hugging after winning
C.everyone jumping and hugging after winning
D.that moment where the ball is about to hit the bat

Answers

I would say D.that moment where the ball is about to hit the bat

The most commonly found types of parietal art are hand stencils and animal paintings


true


false​

Answers

The answer is true..

What is depicted in the image below?

Answers

According to the given the image, was the shown that "David". It was the sculptural works of the early Renaissance.

What is sculptural?

The term sculpture describes two- or three-dimensional works of art. The artwork, The modeling clay that was utilized to create the artwork. The sculpture has a more realistic shape. The artist was the made of the sculpture. The sculpture was the made in the clay and the tools.

Donatello was the created the sculpture of the "David". It was the period as the c. 1440-1460, bronze. It was the sculpture are the early Renaissance. It was the medium of the sculpture is the Bronze. The period was the depicted of the Italian Renaissance. The location of the Bargello National Museum.

As a result, the significance of the sculpture are the aforementioned.

Learn more about on sculpture, here:

https://brainly.com/question/13522451

#SPJ2

Is Roddy Rich Dead AKA, Did he die?

Answers

Explanation:

he isnt dead but his music is dying

Answer:

Nah hes still alive.  I hope he dont die tho.  All these lit rappers dyin way too young. #RiP XXXTentacion.  #Rip JuiceWrld

If you were to be Rich & Famous for something what would it be?

Me: A company

Answers

Answer:

my You Tube channels

Explanation:

UwU

Can you please draw a place that you like it.

Answers

Answer: i dont know how to draw

Answer:

sry it took to long

Explanation:

ok hears one

The modern piano’s ability to play with variable _________ allowed composers in the romantic era to convey a great range of emotions.
_________ enhanced his concert piano performances by turning the piano so his hands could be seen by the audience and memorizing the music.
Miniature _________ are short works that express a single idea.
Identify whether each of the following is a work of Chopin or Liszt based on what you’ve read about each composer.

Transcendental Étude no. 10 in F Minor, an extremely difficult piece for solo piano
Mazurka in B Minor, op. 33, no. 4, based on a Polish dance
Nocturne, op. 9, no. 2, a peaceful composition for solo piano

Answers

Chords hiss’s be Kahn’s avid. Oahu’s s

Read the passage. Then answer the question.

For many athletes, the ultimate victory, for themselves and their country, is winning the Olympic gold. For Jamaican sprinter Usain Bolt, that dream has been achieved many times over. At the 2008 Olympics, Bolt not only won track-and-field gold medals in the 100-meter, 200-meter, and 4x100-meter relay, he broke world records in each event, as well. Then, in the 2012 Olympics, he again won gold medals in all three events, and even broke his own record in the 4x100-meter relay. Truly, Usain Bolt has become a track and field legend!

Which detail from the passage best supports the conclusion that Usain Bolt is one of the fastest sprinters in history?

A. “For many athletes, the ultimate victory, for themselves and their country, is winning Olympic gold.”

B. “For Jamaican sprinter Usain Bolt, that dream has been achieved many times over.”

C. “At the 2008 Olympics, Bolt not only won track-and-field gold medals in the 100-meter, 200-meter and 4x100-meter relay, he broke world records in every event.”

D. “Truly, Usain Bolt has become a track and field legend!”

Answers

Answer:

D

Explanation:

It is the only answer that actually tells us that Usain Bolt is a legend at who he does. Society today assume that if someone is a legend, they are the best of the best, hence why it is D

You have recently been named as the curator at a local art gallery. You have the responsibility of organizing all of the art according to its form. You must look at each piece, decide on its medium, and place it in the correct area of the gallery. Take a look at this piece of art. Where would you place it in the gallery?

Man with a long bushy beard wears a cap and closes his eyes in contemplation. Many sketched lines are visible.

A.
sculpture area

B.
printmaking area

C.
drawing area

D.
photography area

Answers

Answer:

c. drawing area because it says that many sketched lines are visable which could come to the conclusion that this piece is in fact a drawing perhaps.

They look at each piece, decide on its medium, and place it in the correct area of the gallery place it in the gallery drawing area. Thus, option (c) is correct.

What is art?

The term art refers to an artist's creativity and expression. Art is displayed with a message for the viewer. Art is the profession of creating art. It is known as “artist.” Drawing, crafts, paintings, doodling, and other forms of art are all examples of art. The art is mostly color-based on feelings, emotions, and new idea based.

The drawing area because it indicates that numerous drawn lines are visible, leading one to speculate that perhaps this work is a drawing. Drawing lines is completed by using sketches as a guide and coloring in the designated area.

As a result, the art was sketches and lines are only visible in the drawing area. Therefore, option (c) is correct.

Learn more about art, here:

https://brainly.com/question/19049629

#SPJ2

Which statement about Pop Art is true?


It is based on images from ancient cultures.


It shows ordinary subjects and famous subjects.


It has light pastel colors that do not stand out.

Answers

Answer:

it shows ordinary subjects and famous subjects.

Please help my ADD/ADHD (Forgot which one it is exactly) is /not/ letting me focus

Draw a map of Arizona. On your map, note the following:

Nogales’s location, in addition to other nearby cities

major geographical features (for example: deserts, mountains, rivers)

climate information

population

bordering states and the Mexican border

will award brainliest

Answers

But but but but but but

To introduce more drama to an image, a photographer might include which of the following?
Action
Law enforcement personnel
Blood
People

Answers

action, just a guess hope it helps

George Washington was the ____ president of the US. have a great day!​

Answers

Answer:

first

Explanation:

He was the first president, and have a great day too!

first. hope this helps :)

Which sentence uses the word entitled correctly? will give branlyest plss help

One of my sources entitled that dogs make better pets for children than cats do.
The book entitled several other sources to find more information.
The web site, entitled Find Your Best Friend, includes a tool to help you choose a pet.

IF THERE IS ANY LINK I WILL DM BRALY AND REPORT YOU!!!!!

Answers

Answer:

The answer is C) The website, entitled Find Your Best Friend, includes a tool to help you choose a pet.

If you're unsure that my answer is incorrect, you can look up 'entitled' in a dictionary and use that to support your choice.

Hope this helps!

Answer: The website, entitled Find your Best Friend, includes a tool to help you choose a pet

Explanation: Entitled is just a more formal way of saying called or named, and by the way, I've done this quiz.

Read the two stories.


Story 1:
Amelia could not find her dog, Rocky, so she started to look for clues. She searched the fence and discovered a large, muddy hole under one section. She crawled through the hole and walked toward the neighbor’s house. Muddy paw prints covered the porch steps. Amelia knocked on the back door and suddenly heard a bark. She had found her dog.

Story 2:
For the science fair, Peter was measuring how sunlight affected plants. Each day he watered his plants and tracked their progress. One day, he noticed that all the plants were starting to droop. Something was fishy, so Peter began to investigate. He discovered soapy water on the table. Soapy water is harmful to plants. He waited after school and hid behind a desk to see if someone was messing with his plants. Ten minutes later, he saw Emily enter the room, make a soapy mixture, and pour it into the plants. She was caught red-handed.

Which words from the stories help you identify the kind of stories they are?
A. “look for clues,” “search,” “investigate,” and “caught red-handed”
B. “started,” “under one section,” “science fair,” and “Something was fishy”
C. “large, muddy hole,” “walked,” “sunlight,” and “entered the room”
D. “dog, Rocky,” “heard a bark,” “watered his plants,” and “hid behind”

Answers

Answer:

A -“look for clues,” “search,” “investigate,” and “caught red-handed”

Explanation:

Why should athletw not play with the throwing implement

Answers

Orange is the color of the flag

Rhythm worksheet answers please. I did the first line, but I don’t understand the rest.

Answers

Answer:

I'm gonna put random stuff here because the answers are on the pictures above^

Answer:

(line 2 )1 2 3 4 and 1 2 3 4 rest rest 3 4 1 2 3 4 1 2 and 3 4 rest rest rest rest rest rest 1 rest 3 and rest 1 2 3 4 rest rest rest rest

1 2 3 4 1 and 2 and 3 4 1 2 3 4 1 2 3 4 1 and rest 3 rest 1 2 3 4 1 2 3 and 4

1 and 2 and 3 and 4  and 1 and 2 and rest rest 1 2 3 4 1 and 2 and 3 and 4 1 2 3 4 1 2 rest rest 1 2 3 4 1 2 3 4

I think that these should be right, but I can't really see line 4.

Which description is an example of an oral informational format?(1 point) A. a photo of an historic airplane B. C. a diagram of a wave D.a chart of injuries per sport a podcast discussing the Civil War

Answers

Answer:B

Explanation: A podcast during the CIvil War

A description is an example of an oral informational format is a podcast discussing the Civil War. Thus the correct option is B.

What is the oral informational format?

The oral informational format has represented any information that is shared verbally not in written format. The oral information is hared with Speaking skills.

The oral informational format was significant when there is an intended audinece which have lack educational resources due to which they are not able to read and write and can listen to the news orally.

The oral informational format does not require a structured format to share any important news. it requires only effective speaking skills in order to deliver the message with appropriate meaning.

Therefore, option B is appropriate.

Learn more about the oral informational format, here:

https://brainly.com/question/29004649

#SPJ2

hi brendan how are you

Answers

Answer:

s u p

Explanation:

Digital information is stored using a series of ones and zeros. Computers are digital machines because they can only
read information as on or off-1 or 0. This method of computation is known as the______
system

Answers

Answer:

It is known as the binary system.

Explanation: i know this because my uncle is a web developer for a living and he taught me some stuff. I also checked it online and it said it was correct.

Hope this helps.

Luiz doesn’t have a choice. She is going to have to photograph her new baby brother outside around lunchtime even though she knows the light can be really harsh at this time of day. What could Luiz do to try and capture great photos even though it will be midday?
a) Use a rain hood to shade her camera from the harsh sunlight.
b) Put some sunscreen on her brother.
c) Select a spot that will receive direct sunlight.
d) Check the local weather and pick a day that is forecast to be cloudy.

Answers

Maybe d or A. C and B are just not right.

anyone know igpay atinlay?

Answers

Answer:no

Explanation: fortunatelyunay I do not derstandunay igpay atinlay. I'm orrysay I ouldn'tcay be of oremay istanceassay. I illway orkway to be oremay elpfulpay in the uturefay


State FOUR reasons why public participation is important in ensuring
sustainable provision of services to the community ​

Answers

Four reasons why Public Participation is important include;

More independence and autonomy in what they can do.Greater physical benefits including being more active.More opportunity to have a say in matters of direct concern to their lives.More social contact and interpersonal relationships

Aims of Public Participation

The objective of public participation is to encourage the public to have significant input into the decision-making process. Public participation thus provides the opportunity for communication between agencies whose responsibility is to make decisions and the public.

Read more on public participation;

https://brainly.com/question/22719447

Which type of information may be useful?

Answers

Pay attention in class.... :l me

Della is working with layers on a graphic design project, and she wants to make sure that the layers she creates are not changed accidentally. What should she do to ensure this? A. apply a Lock switch OB. apply a Mask layer O C. create an Anchor point OD create a Shape O E. create a Custom Shape​

Answers

Answer:

wait hold on whats the question cause i feel like i know it but i dont xplanation:

Della is working with layers on a graphic design project, and she wants to make sure that the layers she creates are not changed accidentally. She does to ensure this are apply a lock switch. Thus, option (a) is correct.

What is graphic design?

The term graphic design refers to the visual representation of image and shapes. The image is based on vector raster and bitmap. Who design the graphic is called graphic designer. The graphic is design main purpose to design of logo, word art, and advertisement design. The graphic mostly software as Coral Draw, Photoshop, Canva etc.

Della is a graphic designer. She regularly work on design. One day Della was to work on a project of layers on a graphic design. But she wants to know the layers are create on shape, but she check as lock switch. To check layers are create or not. Then apply the lock layer system then check too anciently.

Therefore, option (a) is correct.

Learn more about on graphic design, here:

https://brainly.com/question/10678312

#SPJ2

What are the major characteristics of the Middle Ages to 1642

Answers

Answer:

A small list could be, The plague, agriculture becoming more advanced, the renaissance. Thats just a few things.  

Explanation:

Mainly the plague it was important at that time
Other Questions
Why were Julius and Ethel Rosenberg convicted of treason?They were proven to be spying for the USSR.They tried to attack the US with nuclear weapons.They brought USSR secrets to the US government.They wanted to leave the US to go live in the USSR. Which of the following is a true statement? A. Disruptions in an ecosystem are normal and natural changes.B. Disruptions in an ecosystem are caused by both human activity and environmental disturbances. C. Ecosystems are complex, interactive systems that include both biotic and abiotic components of the environment. D. All of these are true statements. A cylindrical soup can has a radius of 1.1 in. and is 5.4 in. tall. Find the volume of the can and round to the nearest tenths if necessary PLS HELP ASAP WILL MARK BRAINLY!!!. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble? 0.0556 0.0750 0.0167 0.0333 How do I find the next four of the sequence? Use the distributive property to simplify the expressions.1. b(6 + 5b)2. 4( n + 5) RNA: CATTGGCTAACGTCGATAATCGTCGGTAC9. Which amino acids would be found in the mutation protein?Which amino acids would be found in the mutation protein Make x the subject of the formula6(a cx) = 24 True or False: With a given number of moles of solvent, the solution will always have the same concentration Simplify: -(14x)0y(-7)z What is i30A. 1B. -iC. -1D. i Which group suffered the most deaths during the Vietnam War?Vietnamese civilianAmerican soldiersNorth Vietnamese soldiersSouth Vietnamese soldiersPLEASE HURRY Which equation can be used to solve for x in the following diagram?150102 Marcys breakfast table has a square table top with an area of 36 square feet. What is the approximate diagonal length of the table top? Round to the nearest tenth. Figure out length in inches for brainiest and 5 stars. ZABD and ZDBC are supplementary angles.What is the measure of x?x = [?]7DAT110%B>CAngles are not drawn to scale.Enter The number of blueberry muffins made is 40% of the total number of total muffins they make daily. On tueday, the baker makes 60 muffins. How many miffins does the Baker bakes on Tuesday? easy algebra question below first correct answer gets brainliest, if you put one of those links you will get reported and blocked Which value of x makes the inequality -* < 8 true?AX = 32BX = 35x = 34D= 2 What turns the drive shaft of the generator?Help