Answer:
Yes these answers are correct
Explanation:
I hope you did well on the test :)
Answer:
yes
Explanation:
Which feature is most likely found at a divergent boundary?
fold
plateau
fault-block mountain
anticline or syncline
Fault-block mountain is most likely found at a divergent boundary, the correct option is C.
What is a divergent boundary?When 2 tectonic plates move apart from one another, they form a divergent boundary.
Earthquakes are ubiquitous along these boundaries, and magma rises from the Earth's mantle to the surface, solidifying to form new oceanic crust.
Fault-block Mountains are usually form at the divergent boundaries.
Thus, the correct option is C.
For more details regarding divergent boundaries, visit:
https://brainly.com/question/16660809
#SPJ5
Why is Pluto known as dwarf planet? Pluto is considered as dwarf planet because it has not clearedtge neighborhood around its orbit. It orbits in a disc-like zone beyond the orbit of Neptune called the Kuiper belt, a distant region populated with frozen bodies left over from the solar systems' formation.
Answer:
Pluto is known as dwarf planet because it has not cleared the neighborhood around its orbit
Explanation:
Pluto is not considered a planet any more and it is called a dwarf planet because it does not meet one of the international astronomical Union criteria which is " it has not cleared it's neighbouring region of other object" which indicate that it has no gravitational dorminancy and it's tend to share it's orbital space with other neighbouring objects of the same size.
Pluto has mountains, glaciers and thin atmosphere.
Energy pyramids represent the amount of energy available to each trophic level(producers and consumers). Give a reasonable explanation as to why the energy is represented by pyramid shape
Part A: In the Nitrogen Cycle, how does unusable atmospheric nitrogen become usable in the soil?
Part B: In the Carbon Cycle, how do humans influence the greenhouse affect?
Explanation:
Part A:The atmospheric nitrogen (N2) is transfered into Amoniom ion (NH4+) by a special bacteria which lives in soil. This process is called Nitrogen fixation. The Amoniom ion is absorbed by plant.
Part B:When human is breathing CO2 (Carbon dioxide) is coming out to air. CO2 is one of the gasses that has a big influence on green house affect.
Besides، burning fossil fuels by humans is also another example of human effects on green house affect.
Other gasses that have influence on greenhouse affect are:H2O(water) CO2(carbon dioxide) CH4(methane)Wich of the following is a function of the nucleus. A. stores DNA B. Stores sugar C. Builds protein D. Packages proteins
Answer:
it's a
Explanation:
PLEASE HELP 50 POINTS. In Newton's cannonball illustration, what happens if the cannon ball's velocity is slightly faster than the circular orbit speed?
A. the cannon ball will crash into space B. the cannon ball will break orbit and go off into space. C. The cannon ball will have an elliptical orbit
The option that happens if the cannon ball's velocity is slightly faster than the circular orbit speed is option C: The cannon ball will have an elliptical orbit.
What is the Newton's cannonball illustration about?The Newton's cannonball illustration states that when a given ball is said to have gone or travels a little more faster than that of the circular velocity, it will create a kind of an elliptical orbit with the cannon and this is done at the perigee which is said to be the closest point in the orbit.
Note also that If the ball is said to have travels at the escape velocity, the orbit will be tend to open.
Therefore, The option that happens if the cannon ball's velocity is slightly faster than the circular orbit speed is option C: The cannon ball will have an elliptical orbit is correct.
Learn more about circular orbit from
https://brainly.com/question/18496962
#SPJ1
point
Look at the diagram shown below.
geo
cooling melting
- Pagma
me ting
Megamorphia
Rock
weathering and
heat and
erosion
pressure
sediments
weathering and
compaction and
erosion
cementation
weathering and
erosion
heat and
pressure
sedimentary
Rock
Which of these statements best summarizes the information provided by the
diagram?
Melting changes metamorphic rocks into sediments.
Heat and pressure change igneous rocks into metamorphic rocks.
Weathering and erosion change sediments into sedimentary rocks.
Cooling changes igneous rocks into magma.
The best statement that summarizes the information provided by the diagram is heat and pressure change igneous rocks into metamorphic rocks, option (b) is correct.
The diagram implies a process involving the transformation of rocks, and it suggests that the key factor in the conversion is the application of heat and pressure. This aligns with the fundamental process of metamorphism, where pre-existing rocks, including igneous rocks, undergo significant changes in their mineralogy, texture, and structure due to high temperatures and pressures deep within the Earth's crust.
This statement accurately captures the essence of the diagram's representation of rock transformation. It should be noted that the other statements do not align with the depicted process or overlook crucial elements, option (b) is correct.
To learn more about igneous follow the link:
https://brainly.com/question/2500550
#SPJ2
The correct question is:
Which of these statements best summarizes the information provided by the diagram?
a. Melting changes metamorphic rocks into sediments.
b. Heat and pressure change igneous rocks into metamorphic rocks.
c. Weathering and erosion change sediments into sedimentary rocks.
d. Cooling changes igneous rocks into magma.
what are steroids. ?
steroids, also known more properly as anabolic–androgenic steroids, are steroidal androgens that include natural androgens like testosterone as well as synthetic androgens that are structurally related and have similar effects to testosterone.
Explanation:
Answer:
its any of a large class of organic compounds with a characteristic molecular structure containing four rings of carbon atoms (three six-membered and one five). They contain things such as testosterone and they are normally used as drugs to build up muscles in the body.
Explanation:
hope this helps :))
The sequence of nitrogenous bases in DNA varies widely. The sequence of the bases in DNA is most important for which of the following?
Answer: I'm not sure what the choices are, but the answer would be the coding for amino acids/genes/traits. See if you can find something along those lines. Let me know if you need a little more help :)
The sequence of nitrogenous bases in DNA varies widely. The sequence of the bases in DNA is most important for translation.
What do you mean by translation?In molecular biology and genetics, translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins after the process of transcription of DNA to RNA in the cell's nucleus.
DNA translation is the term used to describe the process of protein synthesis by ribosomes in the cytoplasm or endoplasmic reticulum. The genetic information in DNA is used as a basis to create messenger RNA (mRNA) by transcription.
Translation takes place on ribosomes in the cell cytoplasm, where mRNA is read and translated into the string of amino acid chains that make up the synthesized protein.
Learn more about translation:
https://brainly.com/question/17592356
#SPJ6
2. During incomplete dominance, a heterozygote will show
A) blending of traits;
C) only the dominant trait
B) both traits present separately
D) one of the two traits randomly
Answer:
both traits present separately
What cellular process is occurring in the organelle labeled A? DS
5 Points)
udents constructed a diagram to represent two related cellular processes.
ATP
ooooo
B
F. Photosynthesis
G. Cellular respiration
H. DNA replication
J. Protein synthesis
Answer:
Photosynthesis
Explanation:the chloroplast is taking in sunlight
Eukaryotic cells are differentiated from prokaryotic cells
because eukaryotic cells
Answer: eukaryotic cells are found in plants, animals, fungi, and protist.
Explanation:
1
Select the correct answer from each drop-down menu.
What is the black coat color of Lily's dog?
Lily's dog inherited a gene for his black coat color from his parents. The black coat color is the 1 blank, and the gene is blank
1
trait
genotype
phenotype
2
Structure
Dominant
Recessive
Answer:
1. Phenotype
2. Dominant
Explanation:
Phenotype of an organisms refers to the noticeable characteristics of such organisms. According to this question, Lily's dog inherited a gene for his black coat color from his parents. The black coat color is the observed trait of such dog, hence, the black coat color is the PHENOTYPE.
The black color allele is dominant over the white color allele in the color gene, hence, the gene that encodes this black color in Lily's dogs is DOMINANT.
HELP PLS AND THANK YOU. ILL MARK YOU BRAINLIEST.
How does the probability of success of fertilizations change from predators? (specifically fish fertilizations and predators like turtles)
Answer:
External fertilization usually occurs in aquatic environments where both eggs and sperm are released into the water. After the sperm reaches the egg, fertilization can then take place. Most external fertilization happens during the process of spawning where one or several females release their eggs and the male(s) release sperm in the same area, at the same time. The release of the reproductive material may be triggered by water temperature or the length of daylight. Nearly all fish spawn, as do crustaceans (such as crabs and shrimp), mollusks (such as oysters), squid, and echinoderms (such as sea urchins and sea cucumbers). Pairs of fish that are not broadcast spawners may exhibit courtship behavior. This allows the female to select a particular male. The trigger for egg and sperm release (spawning) causes the egg and sperm to be placed in a small area, enhancing the possibility of fertilization.
Explanation:
What cell would pass on to an offspring
Answer:
the answer is prokaryotes
subject is science
Please help me with this
Answer:
1st is form a hypothesis. that's all I know. Sorry.
Explanation:
Which events are likely to be catastrophic to an ecosystem? Select the two
correct answers.
O A. Massive flooding
O B. Steady population growth
O C. Introduction of an unchecked invasive species
D. Spring thunderstorm
O E. Species competition
Answer:
A and C
Explanation:
Steady population growth, spring thunderstorms, and species competing with each other are not bad for the ecosystem.
But when a massive flood happens it can be devastating and destroy very large parts of the land. Also if we introduce an invasive species that becomes unchecked it can destroy a food supply. If the species has no predator that would thin the numbers it can be truly devastating to an ecosystem.
example of asexual reproductionexample of asexual reproduction in plants
Answer:
Plants have two main types of asexual reproduction: vegetative reproduction and apomixis. ... Bulbs, such as a scaly bulb in lilies and a tunicate bulb in daffodils, are other common examples of this type of reproduction. A potato is a stem tuber, while parsnip propagates from a taproot.
Explanation:
ANSWER ASAP will make u brainliest!!
Answer:
not sure
Explanation:
b . plz don't get mad if I choose the wrong answer
Yes, i'm at it again. Help please, thank yous :'D
1. Why would cells in some organs be consuming more oxygen than cells in other organs?
Answer:
Answer is below:
Explanation:
As oxygen molecules diffuse into the cell, they are consumed. But interstitial fluid volume is only a little more than half the intracellular fluid volume. The circulating blood must be brought close to the cells since the systemic organs (tissues) are connected in parallel.
Hope this helps!
Digest the sequences using Haelll. Person 1 GGCCTCGGCCTAGAACGGCCTAGCCG CCGGAGCCGGATCTTGCCGGATCGGC Person 2 CTGAGGCCTAAGCGATTCCCGGATATA GACTCCGGATTCGCTAAGGGCCTATAT
Answer:
Nucleotide fragments of the sequence 1:
1. CCTAGCCGCCGGAGCCGGATCTTGCCGGATCGGC (base 19 to base 52)
2. CCTAGAACGG (base 9 to base 18)
3. CCTCGG (base 3 to base 8)
4. GG (base 1 to base 2)
Nucleotide fragments of the sequence 2:
1. CCTAAGCGATTCCCGGATATAGACTCCGGATTCGCTAAGGG (base 7 to base 47)
2. CCTATAT (base 48 to base 54)
3. CTGAGG (base 1 to base 6)
Explanation:
HaeIII is a restriction enzyme isolated from Haemophilus aegyptius bacteria, which is widely used in molecular biology laboratories. This enzyme is an endonuclease, i.e., it cleaves phosphodiester bonds within a polynucleotide chain. HaeIII is a restriction enzyme that cleaves DNA at the recognition sequence 5′-GG/CC-3'.
When too much water has accumulated in the soil it surfaces and is known as what?
Answer:
Water logging is the condition, in which too much water accumulates in the soil surface. Water logging can result because of over- irrigation of the agricultural field, the increase of the ground water level and flood. Water logging exerts negative impact on the growth of plants and underground microbial and insect population as water gets accumulated in the soil above it's water retention or absorption capacity. It blocks the pores of soil, where the roots of plants, underground soil microbes and insects receives atmospheric oxygen. It may result in death of soil dependent flora and fauna species.
Explanation:
PLEASE HELP ME ASAP, THIS IS DUE TODAY AT 4:00!!
Which term refers to the structure that forms the surface of a cell, separating its contents from the outside world?
Question 6 options:
mitochondria
endoplasmic reticulum
plasma membrane
capsule
Answer:
Endoplasmic reticulum
Explanation:
Answer:
Its plasma membrane
Explanation:
:)
Where do green plants obtain the following for food production?
• Water -
• Carbon (iv) oxide
• Enzymes
• Sunlight
• Chlorophyll
Answer:
sunlight and chlorophyll
the sun produces the energy which the chlorophyll catches to convert to chemical energy and food it also gives the plant a green color a plant may also use this for photosynthesis and other reactions.
Explanation:
Answer:
Green plants get Water and minerals from the soil.Carbon dioxide is available in air so plant get carbon dioxide easily.Enzymes are found in chloroplasts of plant cells which are involved in chemical reaction of photosynthesis.Sunlight is obtained directly from the sun during day time.Chlorophyll is available in the plant.Where does translation occur?
ribosomes
Explanation:
10. Which protist kills more people on earth every year?
Asap
Answer:
Malaria
Explanation:
In fact, malaria is one of the most common infectious diseases on the planet. Malaria is also a very serious disease. It kills several million people each year, most of them children
If you wanted to test whether or not photosynthesis was occurring, what gas would you test for, carbon dioxide or oxygen?
Answer:
Carbon Dioxide
Explanation:
What effect do glaciers have on plant life?
Glaciers bring quantities of minerals that choke plant life as the water runs off melting ice.
Glaciers has no effect on plant life other than helping distribute necessary water.
Glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice.
Glacial flooding is destructive to plant life as silt builds in rivers.
Answer:
CORRECT ANSWER IS Glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice.
Explanation:
The effects that, glaciers have on plant life is glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice. The correct option is c.
What are glaciers?A glacier is a sizable, enduring mass of crystalline ice, snow, rock, silt, and frequently liquid water that forms on land and slides down a slope due to gravity and its own weight. There is melting ice due to global warming.
When glaciers continued to move across Minnesota's landscape thousands of years ago, these lakes were created. When glaciers carved up holes in the earth, ice chunks dropped into them and eventually melted, creating lakes.
Therefore, the correct option is c. Glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice.
To learn more about glaciers, refer to the link:
https://brainly.com/question/20756979
#SPJ2
Which of the following items are the main inputs, or reactants, in cellular
respiration? Select all correct answers.
A. pyruvate
B. glucose
C. carbon dioxide
D. oxygen
Answer:
Oxygen and glucose are both reactants in the process of cellular respiration. The main product of cellular respiration is ATP; waste products include carbon dioxide and water.
What nutrient is matched with its correct function?
o A. fats: main source of energy for the body
O B. carbohydrates: building blocks of hormones and vitamins
OC. proteins: used for growth and repair of the body
O D vitamins: secondary source of energy
Answer:
C
Explanation:
Proteins are used to grow and restore muscle.
Dietary protein aids in cell renewal and repair. Children, teenagers, and expectant women all need protein for healthy growth and development. Therefore, option (C) is correct.
What is the role of protein?Protein is a nutrient that helps our body cells grow and heal (like blood and muscle cells). Your dry body weight is roughly 50% protein. Protein will be converted to carbohydrates if you don't consume enough of them to give you energy.
The body uses protein for a variety of purposes. It promotes metabolic reactions, supports tissue growth and repair, and synchronizes biological processes. Proteins give your body a structural foundation in addition to preserving a healthy pH and fluid balance.
Learn more about protein, here:
https://brainly.com/question/10945907
#SPJ2