Which part of the cell does this illustration represent?
A. Mitochondria
B. Golgi apparatus
C. Endoplasmic reticulum
D. Vacuoles

Chemiosmosos couples electron transport chain in the production of ATP in such a manner electrons are transfered from one molecule to another, and energy released in these electron transfers is used to form an electrochemical gradient.

In chemiosmosis, the energy stored in the gradient is used to synthesize ATP.

Chemiosmosis is the movement of ions across a semipermeable membrane bound structure, down to their electrochemical gradient

Learn more about chemiosmosis:

https://brainly.com/question/9596152

Answer:

Endoplasmic reticulum

Explanation:

Answer:

Its plasma membrane

Explanation:

:)

Answer:

Malaria

Explanation:

In fact, malaria is one of the most common infectious diseases on the planet. Malaria is also a very serious disease. It kills several million people each year, most of them children

Answer:

1. Phenotype

2. Dominant

Explanation:

Phenotype of an organisms refers to the noticeable characteristics of such organisms. According to this question, Lily's dog inherited a gene for his black coat color from his parents. The black coat color is the observed trait of such dog, hence, the black coat color is the PHENOTYPE.

The black color allele is dominant over the white color allele in the color gene, hence, the gene that encodes this black color in Lily's dogs is DOMINANT.

Answer:

Oxygen and glucose are both reactants in the process of cellular respiration. The main product of cellular respiration is ATP; waste products include carbon dioxide and water.

Answer:

Water logging is the condition, in which too much water accumulates in the soil surface. Water logging can result because of over- irrigation of the agricultural field, the increase of the ground water level and flood. Water logging exerts negative impact on the growth of plants and underground microbial and insect population as water gets accumulated in the soil above it's water retention or absorption capacity. It blocks the pores of soil, where the roots of plants, underground soil microbes and insects receives atmospheric oxygen. It may result in death of soil dependent flora and fauna species.

Explanation:

Answer:

External fertilization usually occurs in aquatic environments where both eggs and sperm are released into the water. After the sperm reaches the egg, fertilization can then take place. Most external fertilization happens during the process of spawning where one or several females release their eggs and the male(s) release sperm in the same area, at the same time. The release of the reproductive material may be triggered by water temperature or the length of daylight. Nearly all fish spawn, as do crustaceans (such as crabs and shrimp), mollusks (such as oysters), squid, and echinoderms (such as sea urchins and sea cucumbers). Pairs of fish that are not broadcast spawners may exhibit courtship behavior. This allows the female to select a particular male. The trigger for egg and sperm release (spawning) causes the egg and sperm to be placed in a small area, enhancing the possibility of fertilization.

Explanation:

The best statement that summarizes the information provided by the diagram is heat and pressure change igneous rocks into metamorphic rocks, option (b) is correct.

The diagram implies a process involving the transformation of rocks, and it suggests that the key factor in the conversion is the application of heat and pressure. This aligns with the fundamental process of metamorphism, where pre-existing rocks, including igneous rocks, undergo significant changes in their mineralogy, texture, and structure due to high temperatures and pressures deep within the Earth's crust.

This statement accurately captures the essence of the diagram's representation of rock transformation. It should be noted that the other statements do not align with the depicted process or overlook crucial elements, option (b) is correct.

To learn more about igneous follow the link:

https://brainly.com/question/2500550

#SPJ2

The correct question is:

Which of these statements best summarizes the information provided by the diagram?

a. Melting changes metamorphic rocks into sediments.

b. Heat and pressure change igneous rocks into metamorphic rocks.

c. Weathering and erosion change sediments into sedimentary rocks.

d. Cooling changes igneous rocks into magma.

Answer:

Photosynthesis

Explanation:the chloroplast is taking in sunlight

ribosomes

Explanation:

Answer: eukaryotic cells are found in plants, animals, fungi, and protist.

Explanation:

Answer:

Carbon Dioxide

Explanation:

Answer:

A and C

Explanation:

Steady population growth, spring thunderstorms, and species competing with each other are not bad for the ecosystem.

But when a massive flood happens it can be devastating and destroy very large parts of the land. Also if we introduce an invasive species that becomes unchecked it can destroy a food supply. If the species has no predator that would thin the numbers it can be truly devastating to an ecosystem.

Answer:

it's a

Explanation:

Answer:

Plants have two main types of asexual reproduction: vegetative reproduction and apomixis. ... Bulbs, such as a scaly bulb in lilies and a tunicate bulb in daffodils, are other common examples of this type of reproduction. A potato is a stem tuber, while parsnip propagates from a taproot.

Explanation:

Answer:

B. Make ATP

Explanation:

"The ultimate goal of cellular respiration is  take carbohydrates, disassemble them into glucose molecules, and then use this glucose to produce energy-rich ATP molecules."  

Answer:

d

Explanation:

Explanation:

The atmospheric nitrogen (N2) is transfered into Amoniom ion (NH4+) by a special bacteria which lives in soil. This process is called Nitrogen fixation. The Amoniom ion is absorbed by plant.

When human is breathing CO2 (Carbon dioxide) is coming out to air. CO2 is one of the gasses that has a big influence on green house affect.

Besides، burning fossil fuels by humans is also another example of human effects on green house affect.

Fault-block mountain is most likely found at a divergent boundary, the correct option is C.

When 2 tectonic plates move apart from one another, they form a divergent boundary.

Earthquakes are ubiquitous along these boundaries, and magma rises from the Earth's mantle to the surface, solidifying to form new oceanic crust.

Fault-block Mountains are usually form at the divergent boundaries.

Thus, the correct option is C.

For more details regarding divergent boundaries, visit:

https://brainly.com/question/16660809

#SPJ5

Answer:

Nucleotide fragments of the sequence 1:

1. CCTAGCCGCCGGAGCCGGATCTTGCCGGATCGGC (base 19 to base 52)

2. CCTAGAACGG (base 9 to base 18)

3. CCTCGG (base 3 to base 8)

4. GG (base 1 to base 2)

Nucleotide fragments of the sequence 2:

1. CCTAAGCGATTCCCGGATATAGACTCCGGATTCGCTAAGGG (base 7 to base 47)

2. CCTATAT (base 48 to base 54)

3. CTGAGG (base 1 to base 6)

Explanation:

HaeIII is a restriction enzyme isolated from Haemophilus aegyptius bacteria, which is widely used in molecular biology laboratories. This enzyme is an endonuclease, i.e., it cleaves phosphodiester bonds within a polynucleotide chain. HaeIII is a restriction enzyme that cleaves DNA at the recognition sequence 5′-GG/CC-3'.

Answer:

1st is form a hypothesis. that's all I know. Sorry.

Explanation:

Answer: I'm not sure what the choices are, but the answer would be the coding for amino acids/genes/traits. See if you can find something along those lines. Let me know if you need a little more help :)

The sequence of nitrogenous bases in DNA varies widely. The sequence of the bases in DNA is most important for translation.

In molecular biology and genetics, translation is the process in which ribosomes in the cytoplasm or endoplasmic reticulum synthesize proteins after the process of transcription of DNA to RNA in the cell's nucleus.

DNA translation is the term used to describe the process of protein synthesis by ribosomes in the cytoplasm or endoplasmic reticulum. The genetic information in DNA is used as a basis to create messenger RNA (mRNA) by transcription.

Translation takes place on ribosomes in the cell cytoplasm, where mRNA is read and translated into the string of amino acid chains that make up the synthesized protein.

Learn more about translation:

https://brainly.com/question/17592356

#SPJ6

Answer:

CORRECT ANSWER IS Glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice.

Explanation:

The effects that, glaciers have on plant life is glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice. The correct option is c.

A glacier is a sizable, enduring mass of crystalline ice, snow, rock, silt, and frequently liquid water that forms on land and slides down a slope due to gravity and its own weight. There is melting ice due to global warming.

When glaciers continued to move across Minnesota's landscape thousands of years ago, these lakes were created. When glaciers carved up holes in the earth, ice chunks dropped into them and eventually melted, creating lakes.

Therefore, the correct option is c. Glaciers bring quantities of minerals beneficial to plants as the water runs off melting ice.

To learn more about glaciers, refer to the link:

https://brainly.com/question/20756979

#SPJ2

Answer:

not sure

Explanation:

b . plz don't get mad if I choose the wrong answer

Answer:

South American Plate

African Plate

Antarctica Plate

Explanation:

The Bouvet Triple Junction is a geologic triple junction of three tectonic plates located on the seafloor of the South Atlantic Ocean. It is named after Bouvet Island, which lies 275 kilometers to the east. The three plates which meet here are the South American Plate, the African Plate, and the Antarctic Plate.

Answer:

both traits present separately

Answer:

sunlight and chlorophyll

the sun produces the energy which the chlorophyll catches to convert to chemical energy and food it also gives the plant a green color a plant may also use this for photosynthesis and other reactions.

Explanation:

Answer:

Answer:

the answer is prokaryotes

Answer:

Pluto is known as dwarf planet because it has not cleared the neighborhood around its orbit

Explanation:

Pluto is not considered a planet any more and it is called a dwarf planet because it does not meet one of the international astronomical Union criteria which is " it has not cleared it's neighbouring region of other object" which indicate that it has no gravitational dorminancy and it's tend to share it's orbital space with other neighbouring objects of the same size.

Pluto has mountains, glaciers and thin atmosphere.