Which of the options below describe the
walls of veins?
thick muscle layer & large elastic layer
thin smooth muscle & small elastic layer
only one cell thick

Answers

Answer 1

Answer:

B

Explanation

Veins have thinner and less muscular walls. This is due to the fact that veins have a lower level of pressure than arteries. So, their walls don't need to be as thick to handle the pressure.


Related Questions

Consider the following scenario:



In a muddy lake environment, some fish have brown scales. Most fish, however, have silver scales. Predators have a harder time seeing the fish with brown scales.



Which term best describes the brown scales?



(1 point)



advantageous trait



predominant phenotype



inactivated gene



new mutation

Answers

The brown scales are an advantageous trait because they provide a survival benefit to the fish by making them less visible to predators in their environment. This increased camouflage can result in better chances of survival and reproduction for fish with this trait.

In this scenario, the brown scales on some fish are an advantageous trait because they provide a selective advantage in the specific environment where they live. The brown scales make it harder for predators to see the fish, which can increase their chances of survival and reproduction.

The frequency of the brown scales in the population may increase over time as individuals with this trait are more likely to survive and reproduce. As a result, the advantageous trait becomes more common in the population, potentially leading to a shift in the predominant phenotype of the fish.

This process is an example of natural selection, a key mechanism of evolution.

Therefore, the correct option is an advantageous trait.

Learn more about predominant phenotype:

https://brainly.com/question/506198

#SPJ11

Which gland produces 60 percent of seminal fluid volume, including fructose and prostaglandins?.

Answers

Answer:

Seminal Fluid

Secretions from the seminal vesicles make up about 60 percent of the volume of the semen, with most of the remainder coming from the prostate gland. The sperm and secretions from the bulbourethral gland contribute only a small volume.

Hope this helps :)

Pls brainliest...

What are two ways we can protect animals so that they don’t become extinct?.

Answers

There are many ways that we can protect animals from becoming extinct, but two of the most effective ways are habitat conservation and reducing human impact.

Firstly, habitat conservation involves protecting the natural habitats of animals, such as forests, wetlands, or coral reefs. This means preserving these areas from deforestation, pollution, and other human activities that can destroy or fragment their habitats. By protecting these habitats, we can ensure that animals have access to the resources they need to survive, such as food, water, and shelter.

Secondly, reducing human impact is also important for protecting animals from extinction. This involves minimizing our impact on the environment, such as reducing pollution and greenhouse gas emissions, conserving resources like water and energy, and reducing our reliance on single-use plastics. By reducing our impact on the environment, we can help to protect the natural habitats of animals and reduce the risk of climate change, which can have devastating effects on animal populations.

In conclusion, protecting animals from extinction requires a combination of efforts, including habitat conservation and reducing human impact. By taking steps to protect the environment and the habitats of animals, we can help to ensure that these species are able to thrive and survive for generations to come.

To know more about extinction, refer to the link below:

https://brainly.com/question/14482178#

#SPJ11

Estimate the pore diffusivity, the membrane diffusivity, and the effective diffusivity of a spherically shaped molecule with a molecular weight equal to 35,000 through a membrane containing straight cylindrical pores that are 8 nm in diameter. Assume that the molecule enters the pores of the membrane from a well-stirred bulk solution and that the porosity of the membrane is 0. 40

Answers

The estimated pore diffusivity is 1.78 × 10^-11 m^2/s, the estimated membrane diffusivity is 5.24 × 10^-12 m^2/s, and the estimated effective diffusivity is 1.24 × 10^-11 m^2/s

To estimate the pore diffusivity, membrane diffusivity, and effective diffusivity of a molecule with a molecular weight of 35,000 through a membrane containing 8 nm diameter cylindrical pores, we can use the following formulas:

Pore Diffusivity: D_p = (r_p^2/6) * (1/τ)

Membrane Diffusivity: D_m = (π*r_m^2) * (1/τ)

Effective Diffusivity: D_e = φ*D_p + (1-φ)*D_m

Where:
r_p = pore radius = 4 nm (since the pore diameter is 8 nm)
r_m = membrane thickness = 50 nm (assumed)
τ = tortuosity factor = 1.5 (assumed)
φ = porosity = 0.40 (given)

Using these values, we can calculate:

Pore Diffusivity: D_p = (4^2/6) * (1/1.5) = 1.78 × 10^-11 m^2/s

Membrane Diffusivity: D_m = (π*0.05^2) * (1/1.5) = 5.24 × 10^-12 m^2/s

Effective Diffusivity: D_e = 0.40*(1.78 × 10^-11) + (1-0.40)*(5.24 × 10^-12) = 1.24 × 10^-11 m^2/s

Therefore, the pore diffusivity is 1.78 × 10^-11 m^2/s, the estimated membrane diffusivity is 5.24 × 10^-12 m^2/s, and the estimated effective diffusivity is 1.24 × 10^-11 m^2/s for a spherically shaped molecule with a molecular weight of 35,000 through a membrane containing straight cylindrical pores that are 8 nm in diameter.

To learn more about porosity, refer below:

https://brainly.com/question/29311544

#SPJ11

If the template strand of dna reads: 3-cgaagcgga -5' what will the mrna
transcript read? *

Answers

The mRNA transcript is the single stranded copy of the template strand of DNA that is used to translate the genetic code into proteins.

The mRNA transcript is complementary to the template strand, meaning that it contains the same base sequence but with the opposite orientation. In this case, the template strand is 3'-CGAAGCGGA-5', so the mRNA transcript would be 5'-GCUUCGCUC-3'.

The mRNA transcript is synthesized from the template strand of DNA during the process of transcription, which is the first step in gene expression. In transcription, DNA is used as a template to produce a complementary RNA molecule.

The RNA polymerase enzyme binds to the DNA and reads it in the 3' to 5' direction. It then synthesizes a complementary RNA molecule in the 5' to 3' direction. The mRNA transcript that is produced is then used as a template for protein synthesis.

Know more about genetic code here

https://brainly.com/question/17306054#

#SPJ11

Which organelle in the cardiac muscle stores calcium?.

Answers

The organelle in the cardiac muscle that stores calcium is the sarcoplasmic reticulum (SR). The SR is a specialized type of endoplasmic reticulum found in muscle cells, including cardiac muscle cells.

It is responsible for regulating the levels of calcium ions in the cytoplasm, which is crucial for muscle contraction.

When a cardiac muscle cell is stimulated to contract, calcium ions are released from the SR into the cytoplasm. This influx of calcium ions triggers a series of biochemical reactions that ultimately lead to muscle contraction. When the contraction is complete, the calcium ions are pumped back into the SR, where they are stored until the next contraction.

The importance of the SR in cardiac muscle function is highlighted by the fact that mutations in genes that encode proteins involved in SR function can lead to heart disease. For example, mutations in the gene that encodes the SR calcium release channel (ryanodine receptor) are associated with arrhythmias and heart failure.

In summary, the sarcoplasmic reticulum is the organelle in the cardiac muscle that stores calcium, and its proper function is essential for normal cardiac muscle contraction and heart health.

To know more about sarcoplasmic reticulum, refer to the link below:

https://brainly.com/question/31593862#

#SPJ11

How do the skulls of adult chimpanzees and humans differ?.

Answers

The skulls of adult chimpanzees and humans differ in various ways, reflecting the evolutionary divergence between the two species.

One of the most prominent differences is the size and shape of the braincase, with humans possessing a significantly larger and more globular braincase relative to chimpanzees.

In addition, the face and jaws of chimpanzees are more prognathic, or jutting forward, whereas in humans the face is flatter and the jaws are more vertical. Chimpanzees also have prominent brow ridges, which are largely absent in humans.

Overall, the differences between chimpanzee and human skulls reflect adaptations to different selective pressures, including changes in diet, social behavior, and cognitive abilities, over the course of millions of years of evolution.

To know more about the evolutionary divergence refer here :

https://brainly.com/question/15990140#

#SPJ11

Which type of animal could live in a temperate deciduous forest?

O one that is adapted to hot summers and cold winters

O one that prefers only extremely cold temperatures

O one that does not build their
homes amid trees

O one that prefers a climate with little rain or snow

Answers

Answer:

one that is adapted to hot summers and cold winters

Explanation:

A temperate deciduous woodland can support animals that are acclimated to scorching summers and frigid winters. These woods have a mild environment, with warm summers and chilly winters, and are distinguished by trees that shed their leaves in the autumn. Animals that live in these woods have adapted to periodic shifts by hibernating, migrating, or altering their diet. Deer, squirrels, bears, wolves, rabbits, and different bird species are instances of creatures that reside in temperate deciduous woods.

Inherited traits of individuals are governed in the genetic material found in the genes within chromosomes in the nucleus. This diagram shows the genetic basis of inherited traits. In the diagram D is a chromosome. What can you infer about the relationship of genes, chromosomes, and DNA? Select ALL that apply.

Answers

Based on the given information in the question, we can infer the following relationships between genes, chromosomes, and DNA:

Genes are located on chromosomesChromosomes contain DNA

What are Inherited traits?

Genes are located on chromosomes: Genes are specific sequences of DNA that are located on chromosomes, which are thread-like structures made up of DNA and proteins found in the nucleus.

Chromosomes contain DNA: DNA is the genetic material that is found within the chromosomes in the nucleus of a cell. It is a long, double-stranded molecule that carries the genetic information required for the development and function of living organisms.

Therefore, we can infer that genes are specific sequences of DNA that are located on chromosomes, which are thread-like structures made up of DNA and proteins found in the nucleus.

Learn more about traits  from

https://brainly.com/question/930507

#SPJ1

Explain why it is unusual for Calix to be a male calico cat.


Explain how we know Calix has extra DNA


be sure to talk about the experiments and


use the new vocab you learned (point mutation, chromosomal rearrangement, nondisjunction)


How does the calico pattern affect Calix (his health) ?

Answers

It is unusual for Calix to be a male calico cat because the majority of calicos are female. Calicos are characterized by their distinctive fur color pattern, which is composed of black, white, and orange patches.

This specific pattern is caused by a combination of a point mutation and a chromosomal rearrangement. The point mutation causes the fur to be black or orange, and the chromosomal rearrangement causes the patches of these colors to be in different places.

The chromosomal rearrangement is caused by a process known as nondisjunction, which is when two chromosomes fail to separate during the formation of gametes, resulting in an extra set of chromosomes. This extra set of chromosomes is what causes Calix to be male.

The extra DNA in Calix does not affect his health in any way. The calico pattern does not cause any health issues as it is a purely aesthetic trait. He is still a healthy cat and has a normal lifespan. The calico pattern is just a unique trait that sets him apart from other cats.

Know more about chromosomal rearrangement here

https://brainly.com/question/31623842#

#SPJ11

How does this illustrate that the scientific community is more willing to revise their thinking regarding biological evolution than many critics assert?

Answers

The scientific community's willingness to revise their thinking regarding biological evolution can be seen in the ongoing debates and discussions surrounding the topic.

While the basic tenets of evolution by natural selection have remained largely unchanged since the time of Darwin, new evidence and discoveries have prompted revisions and updates to the theory.

For example, the discovery of DNA and the advent of molecular biology have led to a greater understanding of the mechanisms of inheritance and evolution, and have prompted revisions to the traditional view of the tree of life. Additionally, the study of epigenetics has challenged the notion that genetic traits are solely determined by DNA sequences.

To learn more about evolution follow the link:

https://brainly.com/question/30893161

#SPJ4

the red scare and the growth of the ku klux klan were similar as both were influenced by –

Answers

The Red Scare and the growth of the Ku Klux Klan were influenced by fear and intolerance.

How did fear shape the Red Scare and ku klux klan ?

During the Red Scare, The influenced which took place in the United States during the early 20th century, there was a widespread fear of communism and radical political ideologies, particularly among the political and business elite. This fear was fueled by a series of events, including the Russian Revolution of 1917 and a series of bombings carried out by anarchists in the United States.

The Ku Klux Klan, on the other hand, emerged in the aftermath of the American Civil War and aimed to preserve the social and political dominance of white Americans, particularly in the South. The Klan targeted African Americans, Jews, Catholics, immigrants, and other groups that were perceived as threats to the white, Protestant, and Anglo-Saxon identity of America.

Both the Red Scare and the Ku Klux Klan were characterized by a climate of fear, suspicion, and intolerance towards those who were deemed as different or threatening to the established social order. Both movements used fear-mongering, propaganda, and violence to achieve their goals, which often included the suppression of civil liberties and the persecution of minority groups.

Learn more about influenced

brainly.com/question/31375374

#SPJ11

in many signaling pathways, once a signaling molecule binds to a receptor, the receptor becomes phosphorylated. this initial phosphorylation step best demonstrates: receptor activation. termination. cellular response. signal transduction. either cellular response or signal transduction.

Answers

In many signaling pathways, once a signaling molecule binds to a receptor, the receptor becomes phosphorylated. this initial phosphorylation step best demonstrates: receptor activation.

In many signaling pathways, the binding of a signaling molecule to its receptor initiates a cascade of events that ultimately leads to a cellular response. One of the earliest events in this cascade is the phosphorylation of the receptor. This initial phosphorylation step best demonstrates receptor activation, as it triggers a conformational change in the receptor that allows it to interact with downstream signaling proteins.

Receptor activation sets off a series of events known as signal transduction, which involves the propagation of the signal from the receptor to intracellular targets. This process involves the activation of various signaling pathways, such as protein kinase cascades, and ultimately leads to a cellular response.

For more such questions on signaling pathways, click on:

https://brainly.com/question/29641631

#SPJ11

An organism that exhibits a head with sensory equipment and a brain probably also ________. Group of answer choices is segmented is bilaterally symmetrical is diploblastic has a coelom

Answers

Answer:

Is bilaterally symmetrical.

Explanation:

An organism that exhibits a head with sensory equipment and a brain probably also is bilaterally symmetrical.

An organism that exhibits a head with sensory equipment and a brain probably also is bilaterally symmetrical.

Bilateral symmetry refers to the arrangement of body parts in such a way that the organism can be divided into two nearly identical halves along a central axis. This type of symmetry is commonly associated with organisms that have a distinct head region, sensory organs concentrated in that region, and a centralized nervous system, such as a brain.

Bilateral symmetry allows for efficient movement, coordination, and the development of specialized sensory structures, facilitating the organism's interaction with its environment. Segmentation refers to the division of the body into repeated segments, which may or may not be present in organisms with a head and brain. Diploblastic refers to organisms with two germ layers, while the presence of a coelom indicates a body cavity.

Learn more about Bilateral symmetry, here:

https://brainly.com/question/32433996

#SPJ6

Mom is heterozygous A and dad is type AB blood type. Do the Punnett square. What are the chances the offspring will be type B

Answers

Dad is type AB

Mom is heterozygous type A which is Ao

after drawing the punnet square (the image attached) you will find that mom and dad produced offsprings with the genotypes: AA, AB, Ao, and Bo

Parent AB X Ao offspring probabilities

1/4 type AB (25%)

1/4 type B (25%)

1/2 type A (50%)

hope this helps :)

If the scarcity of water is going to create


winners and losers, who will usually win out?


poor citizens


industry and businesses


refugees


regular citizens

Answers

If the scarcity of water continues to worsen, regular citizens will need to take action to conserve and properly manage their water usage. This can be done through simple practices such as fixing leaky faucets and using water-efficient appliances. The correct option is D. regular citizens

Additionally, individuals can adopt habits such as taking shorter showers and turning off the tap while brushing their teeth.

In addition to personal efforts, communities can come together to implement water conservation measures. This can include investing in water infrastructure improvements and promoting rainwater harvesting. Government policies and regulations can also play a significant role in managing water scarcity, including implementing water usage restrictions and incentivizing businesses to reduce their water usage.

Ultimately, it is important for individuals and communities to take proactive measures in order to address the issue of water scarcity. By working together and making small changes in daily habits, we can help ensure that future generations have access to clean and sufficient water resources.

To know more about scarcity of water click here:

https://brainly.com/question/19920929

#SPJ11

1.)What is wave?
2.)What is medium?
3.)What do waves transport from one location to another without actually displacing matter from one
location to another?
4.) What are some mediums sound waves can travel through?
5.) What kind of wave does not require a medium to transport energy from one location to another?
6.) Describe how you think a sound wave propagates (travels) through air.
7.) Why is there no sound in space?

Answers

1) A transfer of energy
2) A substance that a wave travels through
3) Energy
4) Water,air,a wall
5) Light wave
6) It vibrates the air particles and sends a sound wave in that general direction
7) Because there is no medium for the sound waves to vibrate

Hope this helps! :)

SOS HELPPPPP Please help these 3 are Biology questions i need a hand with
For three answers i will give 30 points no trolls

Answers

Number 2 for 9 and number 4 for 10 and for 8 it’s one. I hope I’m not too late!

How did scientists probably date the extrusion and intrusion?

Answers

The scientists probably date the extrusion and intrusion through dating a sample of that rock, Radioactive dating.

How do scientists date intrusions and extrusions?

Radioactive dating  can be  seen as one that is been used by the scientist and can be considered as one that provide the ages of particles,  however in this case not the sedimentary rock as a whole.

It should be noted that hrough dating a sample of that rock, thenthe extrusion can be known which can be250 million years old however the intrusion extends from the bottom layer  up to the earliest one.

Learn more about extrusion at:

https://brainly.com/question/16022996

#SPJ1

You are researching the feeding habits of an omnivorous species of paramecium and have established a colony in which the individuals have identical genetic make ups for chromosome 1. you split the colony into two tanks. tank 1 is fed bacteria and tank 2 is fed green algae. after several months, you run the genetic analyses again and find that the paramecium in tank 1 have a new gene inserted within chromosome 1, while the paramecium in tank 2 do not have this gene insertion. after some investigation, you find that the new gene is 99% similar to a gene found in the bacteria fed to tank 1. what is the most likely explanation for this insertion

Answers

The most likely explanation for the insertion of the new gene in the paramecium from tank 1 is horizontal gene transfer.

This is the transfer of genetic material between organisms that are not parent and offspring. The paramecium in tank 1 likely acquired the gene from the bacteria they were consuming as part of their diet.

This type of transfer can occur through mechanisms such as transformation, transduction, and conjugation. The fact that the new gene is 99% similar to a gene found in the bacteria supports the hypothesis that it was acquired through horizontal gene transfer.

It is also important to note that the paramecium in tank 2 did not acquire the new gene, likely because they were not consuming the bacteria that carried it.

To learn more about bacteria, refer below:

https://brainly.com/question/8008968

#SPJ11

which of the following are true of both endocytosis and exocytosis? multiple select question. transport large molecules occur through osmosis involve vesicles occur at the cell membrane result in net movement into the cell

Answers

The following statements are true of both endocytosis and exocytosis:

Occur at the cell membrane.Involve vesicles.Transport large molecules.What is exocytosis?

Statements 1, 2, and 3 are true of both endocytosis and exocytosis. Endocytosis is the process of bringing substances into the cell by forming vesicles from the cell membrane, while exocytosis is the process of releasing substances from the cell by fusing vesicles with the cell membrane.

Statement 4 is true only for endocytosis and exocytosis, as both processes involve vesicles.

Statement 5 is false for exocytosis, as it results in net movement out of the cell, while it is true for endocytosis, as it results in net movement into the cell.

Learn more about exocytosis from

https://brainly.com/question/22040783

#SPJ1

which of the following are true of both endocytosis and exocytosis

1. occur throuh osmosis

2. transport large molecules

3. occur at the cell membrane

4. involve vesicles

5. result in net movement into the cell

How did agriculture change the pattern of human population growth?

Answers

Agriculture allowed humans to produce food on a larger scale, which meant that they could settle in one place rather than constantly moving to find food.

This led to the development of permanent settlements and the growth of human populations in these areas.

Agriculture also allowed for a more reliable and consistent food supply, which in turn allowed populations to grow more quickly.

The ability to store surplus food also led to the development of trade, which facilitated the exchange of goods and ideas between different populations, further contributing to population growth.

Overall, agriculture was a major factor in the development of human civilization and the growth of human populations.

To know more about Agriculture, refer here:

https://brainly.com/question/12568494#

#SPJ11

How CAP, cAMP, and the CAP binding site relate to a gas pedal in the lac operon

Answers

In the lac operon, cAMP acts as a signal molecule that activates the catabolite activator protein (CAP), which then binds to a specific DNA sequence known as the CAP binding site upstream of the promoter region.

This binding increases the affinity of RNA polymerase for the promoter, which leads to increased transcription of the lac genes.

The role of cAMP and CAP in the lac operon can be likened to a gas pedal in a car, where cAMP is the signal that activates CAP, and CAP binding to the DNA is akin to stepping on the gas pedal, leading to increased transcription of the lac genes.

Therefore, cAMP and CAP act together to regulate the lac operon in response to glucose availability, allowing the bacteria to efficiently utilize lactose as an alternative carbon source.

To know more about promoter region refer here:-

https://brainly.com/question/30552510#

#SPJ11

Fig 11 shows a cell from an organism. (a) (i) In which type of living organism are cells similar to the one shown in Fig. I.I normally found? (ii) State two reasons for your choice of living organism in (i) Fig. 1.2(a) shows the same cell after it had been placed in solution A for ten minutes. The cell was then transferred to solution B and Fig. 1.2(b) shows how it appeared after a further ten minutes (b) Explain what is occurred to cause the cell to appear as it does in Fig. 12(a) (c) Compared with the water potential of the cell, what can be deduced about solutions A and B (d) What will be found in region C in Fig 1.20b) at the end of the experiment and explain your answer​

Answers

Through osmosis, water moves from a more diluted solution to a more concentrated one. (a) (i) This cell is found in plants. (ii) The cell has a nucleus and cell wall. (b) water moved by osmosis from the solution to the cell interior, increasing its size. (c) A is hypotonic (higher water potential), B is hypertonic (lower water potential). (d) In region C, there are empty spaces left between the cell wall and the cell membrane.

What is osmosis?

Osmosis is the simple passive transport of water molecules that occurs when two dilutions of different concentrations are separated by a semipermeable membrane.

Water can move from the most diluted side to the less diluted one. This is, from the side of the membrane with higher water potential, to the side with lower water potential.

Let us remember that the water potential is the potential energy in a mass of water. Among other factors, it depends on solute concentration,

• Most diluted side ⇒ higher water potential ⇒ hypotonic solution

• Most concentrated side ⇒ lower water potential ⇒ hypertonic solution

Fig 1.1 (a)

(i) This type of cell is usually found in plants

(ii) This cell has a nucleus (eukaryotic organisms) and cell wall (plant cells)

Fig 1.2

(b) Figure 1.2-a shows a swelled plant cell. This change suggests that water moved from the solution to the cell interior, increasing its size.

Water tends to go from the hypotonic solution (higher water potential) to the cell interior (lower water potential) and keeps doing so until concentrations are equal in the cell interior and the solution.

The cell changed its shape as water moved, the cell began to enlarge and became bigger-sized.

(c)

Solution A is hypotonic to the cell, meaning it is more diluted than the cell interior. This solution has a higher water potential.Solution B is hypertonic to the cell, meaning it is less diluted than the cell interior. This solution has a lower water potential.

(d)

When the cell is transferred from solution A (hypotonic) to solution B (hypertonic) water moves from the cell interior to the solution. This motion causes the cell to shrink.

When the cell shrinks, the cell membrane loses its shape, but the cell wall remains the same. Hence, little empty spaces are created between the cell wall and the cell membrane.

In region C, we can find empty spaces left between the cell wall and the cell membrane after the cell shrunk.

You can learn more about osmosis at

https://brainly.com/question/31028904

#SPJ1

. The Galápagos Islands in the Pacific Ocean
have varied habitats. Adaptive radiation
occurred on these islands in finch populations,
meaning that the finch species that live there
A. have lived unchanged through long periods
of stability
B. have become more like each other in
response to their habitats
C. changed rapidly from an ancestral species
into many new forms
D. changed in response to changes in other
species they interact with

Answers

Answer:

b

Explanation:

Adaptive radiation occurred on these islands in finch populations, meaning that the finch species that live there have become more like each other in response to their habitats, hence option B is correct.

What is adaptive radiation?

A rapid growth in the number of species sharing a common ancestor that is characterized by high ecological and morphological variety is known as adaptive radiation. It is driven by organisms' ability to adapt to novel ecological situations.

The Galapagos Islands offered numerous open niches to the ancestors of finches without any competing species, which helped to facilitate their adaptive radiation.

These finches have evolved to fill a variety of unfilled niches with various conditions. New species were created as a result of this process.

Therefore, option B is correct.

Learn more about adaptive radiation, here:

https://brainly.com/question/14598336

#SPJ2

Background:
there was a tarantula discovered at knightsen school. mr. yurkovich when there as a child, grew up in the area, and still lives nearby. he has never heard of tarantulas being observed at the school before this. tarantulas eat primarily grasshoppers and beetles.

question:
what will happen to the populations of beetles, now that tarantulas are a new part of their environment? will the population increase or decrease?

ignore the name its just my principles

Answers

The introduction of tarantulas to the environment may have an impact on the population of their primary food source, grasshoppers and beetles.

Tarantulas are known to consume a significant amount of these insects, which may lead to a decrease in their population over time.

However, the impact of the tarantulas on the beetle population is difficult to predict and depends on a variety of factors such as the number of tarantulas, the availability of other food sources, and the habitat suitability for beetles.

It is possible that the beetle population may decline in the short term, but it may also adapt to the new environment and stabilize over time.

To know more about tarantulas refer here :-

https://brainly.com/question/31212972#

#SPJ11

TEKS 7. 10A


6. Many plants of the tropical rain forest are successful houseplants. What characteristics make


these plants successful indoors?


PLEASE HELP

Answers

Tropical rainforest plants are popular houseplants because they possess several characteristics that make them successful indoors. First, they are usually low-maintenance, requiring minimal pruning and watering.

They also typically do not require direct sunlight, so they can thrive in indirect light, common in most indoor environments. Furthermore, they are typically slow growing plants, so they do not need to be repotted often and will not quickly outgrow their pot.

Finally, many tropical rainforest plants have attractive foliage and colorful flowers, making them aesthetically pleasing additions to the home. All of these characteristics make tropical rainforest plants ideal for indoor use.

know more about Tropical rainforest here

https://brainly.com/question/235998#

#SPJ11

Ecologists have listed four main ways that species and individuals affect other—competition, ___________and prey, symbiosis, and coevolution.

Answers

Ecologists have listed four main ways that species and individuals affect other—competition, predation and prey, symbiosis, and coevolution.

Which famous comedian was diagnosed with narcolepsy?.

Answers

The famous comedian who was diagnosed with narcolepsy is Jimmy Kimmel.

Narcolepsy is a neurological disorder that affects the brain's ability to regulate sleep-wake cycles. People with narcolepsy experience excessive daytime sleepiness and sudden, uncontrollable episodes of sleep called "sleep attacks." Other symptoms may include cataplexy (sudden loss of muscle tone), sleep paralysis, and vivid hallucinations during sleep onset or upon waking up.

Jimmy Kimmel revealed his narcolepsy diagnosis in 2019 during an episode of his talk show, "Jimmy Kimmel Live." He shared his experience of falling asleep during meetings and even while hosting the Oscars. He also described how he underwent a sleep study and was diagnosed with narcolepsy, which he manages with medication and lifestyle adjustments.

Kimmel's public disclosure of his narcolepsy has helped raise awareness about the disorder and reduce the stigma associated with it. It also highlights the importance of seeking medical attention for sleep-related issues and the impact of sleep disorders on daily functioning.

To know more about the Narcolepsy refer here :

https://brainly.com/question/25152811#

#SPJ11

What must be true about the number of chromosomes to create fertilized cell?

Answers

In order to create a fertilized cell, the number of chromosomes in the sperm and egg must be equal. This is because during fertilization, the sperm and egg combine to form a zygote, which is the first cell of the new organism. The zygote contains the full complement of chromosomes that will determine the characteristics of the organism. If the number of chromosomes in the sperm and egg were not equal, the zygote would not be viable and the organism would not develop properly.

Other Questions
Compare Zora Neale Hurston's Sweat with Spunk For an experiment, Bea recorded how much each of 14 seedlings grew in one month. She made a line plot to show the data. Which value occurred most often? Anyone know how to solve this? Can anybody help me ASAP 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC when an investor compares their required return to the expected return on an investment, they are utilizing the explain in 100 words Compare the similarities between Capitalism and Socialism. Garcia Co. Sells snowboards. Each snowboard requires direct materials of $112, direct labor of $42, and variable overhead of $57. The company expects fixed overhead costs of $659,000 and fixed selling and administrative costs of $125,000 for the next year. It expects to produce and sell 11,200 snowboards in the next year. What will be the selling price per unit if Garcia uses a markup of 10% of total cost find the next three terms in the sequence 3/4, 1/2, 1/4, 0 Acme corp. is a leading provider of radios to the commercial market. its products all rely on printed circuit-board technology. acme has protected its market leadership with continued advancements in this technology, which it patents. a competitor has developed a radio for this market with equal performance but uses a software-based technology instead of circuit boardsis acme's technology leadership(compeptitive advantage) sustainable? why/ why not (what capability tests does acme's technology leadership fail?) calculate the molality of a solition with 85 g of KOH added to 590. g of water The amount of uniformity in the size of rock or sediment particles is called find the distance between each pair of points. (5 1/2, -7 1/2) and (5 1/2, -1 1/2) The figure shows a 25-cm-long metal rod pulled along two frictionless, conducting rails at a constant speed of 3. 5 m/s. The rails have negligible resistance, but the rod has a resistance of 0. 65 The Preamble includes the phrase "to form a more perfect union." Why is this reason listed for creating a new Constitution? A. because the people believed that the British had been unfair rulers B. because the United States would unite all of North America under one government C. because the government under the Articles of Confederation had not been effective D. because the new government was meant to be ruled by the people Christine has 5 coloured sweets in a bag. 1 of the sweets are red and 4 are green. She removes a sweet at random from the bag, notes the colour, and does not replace the sweet in the bag. She then chooses a second sweet at random. P(double green) P(Red | green) P( ) P(Green) Two days after he bought a speedometer for his bicycle; Lance brought it back (0 the Yellow Jersey Bike Shop. FThele problemn with this speedomeler;' Ba Lance complained to the clerk "Yesterday [ cycled the 22-mile Rogadzo Road Trail in 70 minutes and nOt once did the speedometer read above [5 miles per hour"" Yeah?" responded the clerk " What' $ the problem?" To explain Lance's complaint, first compute his average velocity: (Use decimal notation. Give your answer tO two decimal places ) average velocity: DNE mileshcur Incorrecr Let E be the smallest region enclosed by the cone Z = - no Ix + y and the sphere x2 + y2 + z2 = 32 (note, it is the same region as in Question 8). Then, using spherical coordinates we can compute the volume of E as b d t Vol(E) = = [F(0,0,6) d do dp, a Cs where F(0,0,0) = a = b = = d = S = t = College Level Trigonometry!!! Use the following information to create a two way table that shows the type of music a person likes compared to their gender. 94 males were surveyed. 13 males liked jazz. 27 females liked rock. 90 people total liked rock. 66 females liked country. 200 people total were surveyed