Which is your favorite fast food

A. McDonald’s

B. Taco Bell

C. Wendy

D. Domino’s

E. Other

Will give brainlist

Answers

Answer 1

Answer:

MCDONALD ALL THE WAYY YESSIRRR


Related Questions

Select the correct text In the passage.
Which three lines In this excerpt from Edgar Allan Poe's "Annabel Lee" contaln alliteration?
The angels, not half so happy In Heaven,
Went envying her and me-
Yesl-that was the reason (as all men know,
In this kingdom by the sea)
That the wind came out of the cloud by night,
Chilling and killing my Annabel Lee
For the moon never beams, without bringing me dreams
Of the beautiful Annabel Lee;
And the stars never rise, but | feel the bright eyes
Of the beautiful Annabel Lee;
And so, all the night-tide, lle down by the side
Of my darling-my darling-my life and my bride,
In her sepulchre there by the sea-
In her tomb by the sounding sea.

Answers

The angels, not half so happy In Heaven,

Went envying her and me-

Yesl-that was the reason (as all men know,

In this kingdom by the sea)

That the wind came out of the cloud by night,

Chilling and killing my Annabel Lee

For the moon never beams, without bringing me dreams

Of the beautiful Annabel Lee;

And the stars never rise, but | feel the bright eyes

Of the beautiful Annabel Lee;

And so, all the night-tide, lle down by the side

Of my darling-my darling-my life and my bride,

In her sepulchre there by the sea-

In her tomb by the sounding sea.

Answer:

Other person is right

Explanation:

PLATO2022

In my opinion, I think prayer in school should be allowed because

Answers

Answer:

some people are very religious and people should go with what they believe

it might make people feel better and more focused

Answer:

Choice 1: Freedom of expression is highly encouraged in our country. People express themselves in different ways and it is accepted. Prayer is not allowed freely in schools. This is ridiculous. Prayer is only accepted when there is a tragedy and we are in need

Choice 2: Prayer in schools would dramatically decrease bullying. Prayer unites groups of people. If group prayer was allowed in school, there will be a better understanding of right and wrong among people. Prayer also will make people acknowledge that there is something bigger than us. This leads to less reliance on things such as sex, drugs and alcohol.

What are out-of-order rooms? How do they differ from out of inventory rooms

Answers

Answer:

Out-of-order rooms are those that have slight problems that could cause a negative impression with a guest.  Out-of-order rooms are those that have slight problems that could cause a negative impression with a guest.

Explanation:

I just did my text questions

37. The only thing that the earth needed, was a downpour.
(Select the correct use of 'What'.)
A. The only thing what the earth needed, was a downpour.
B. What was a downpour that the earth needed.
C. What the earth needed, was a downpour.
D. The earth needed the only thing what was a downpour.​

Answers

D because I’m order to know what this earth needs, it’s to do the downpour

I replied I would like to have grill chicken. where do i put Commas and quotients at.​

Answers

Answer:

I replied, "I would like to have grilled chicken."

Explanation:

The comma would go right before the person starts talking, and quotations around what they're saying.

In “We’re Going to Mars!” the author’s viewpoint is that travel to Mars is likely in the near future.

How is this viewpoint best conveyed in the text?


He lists the benefits of NASA exploring and colonizing Mars and other planets.

He argues that the cost of a human mission to Mars is expensive.

He describes the detailed plans and timelines for a NASA mission to Mars.

He emphasizes the impact colonizing Mars will have on humanity.

Answers

Answer:

The correct answer is C: He describes the detailed plans and timelines for a NASA mission to Mars.

Explanation: Took the K12 unit test

Hope I helped

Answer:

the answer is C:

He describes the detailed plans and timelines for a NASA mission to Mars.

Explanation:

In this scene from the novel Exit West, using the psychoanalytic lens, what do learn?
“Someone had told them the best times to fish were at dawn and dusk, so they stayed out alone longer than they otherwise might have. It was getting dark when they saw four men in the distance, approaching along the beach. Nadia said they should go, and Saeed agreed, and the couple walked away quickly, but the men seemed to follow, and Saeed and Nadia increased their pace, increased it as much as they could manage, even though Nadia slipped and cut her arm on the rocks. The men were gaining on them, and Saeed and Nadia began to wonder aloud what of their things they could leave behind to lighten the load, or as an offering that might sate their pursuers. Saeed said perhaps the men wanted the rod, and this seemed more reassuring to them than the alternative, which was to consider what else the men might want. So they dropped the rod, but soon after they rounded a bend and saw a house and outside the house were uniformed guards, which meant the house contained a door to a desirable place, and Saeed and Nadia had never been relieved to see guards on the island, but they were now. They came close, until the guards shouted at them to stay back, and there Saeed and Nadia stopped, making it clear they would not try to rush the house, sitting down where the guards could see them, where they felt safe, and Saeed considered whether to run back and retrieve the rod, but Nadia said it was too risky. They both regretted dropping it now. They watched for a long while but the four men never appeared, and the two of them set up their tent right there, but were unable to sleep much that night."

Answers

Answer:

The central theme of Exit West is expressed by the title, which refers to the migration of people from war-torn or impoverished regions to the global "West": prosperous and tolerant nations where migrants hope to make a better life

What is your favorite form of communication
and why?

Answers

Answer:

texting because I don't get as socially drained as quickly as other forms of communication would.

Explanation:

M e s s a g e s and texts, since cause of C o v i dat the time of this answer)

What is revealed through dialogue about the women’s feelings toward Paris? Select 3 options. Nurse thinks Paris is extremely handsome. Nurse thinks Paris is too old for Juliet. Lady Capulet feels Paris would be a good match for her daughter. Lady Capulet feels Paris is too young and impoverished for Juliet. Lady Capulet hopes Juliet will be interested in Paris.

Answers

Answer: (A.) Nurse thinks Paris is extremely handsome.

              (C.) Lady Capulet feels Paris would be a good match for her daughter.

               (E.) Lady Capulet hopes Juliet will be interested in Paris.

Explanation: i did it on edge and got 100%

Lady Capulet feels Paris would be a good match for her daughter. Lady Capulet hopes Juliet will be interested in Paris. Nurse thinks Paris is extremely handsome.

Who is Lady Capulet?

Lady Capulet is a character in William Shakespeare's play "Romeo and Juliet." She is the wife of Lord Capulet and the mother of Juliet.

Lady Capulet is portrayed as a wealthy, aristocratic woman who is preoccupied with social status and appearances.

She is concerned with arranging a suitable marriage for her daughter Juliet and does not seem to be very involved in her daughter's life beyond this.

Lady Capulet is also shown to be somewhat cold and distant towards Juliet, as she has delegated most of the responsibility of raising her daughter to the Nurse.

Overall, Lady Capulet is a minor character in the play, but her role is significant in portraying the social norms and expectations of the time period in which the play is set.

Learn more about Lady Capulet here:

brainly.com/question/27850355

#SPJ7

why does june’s mother keep giving her tests?

Answers

Answer:

If this is a riddle I would say to test her IQ and to see how inteligente she is.

“Experience is a keen teacher;” meaning?

Answers

Answer:

I beleive the meaning of this phrase is the expreiencing somethng is like a new teacher teaching you something new

Explanation:

I hope this helps.

Answer:

When you have experience in something, you are always looking forward to do it since you're so good at it, in other words, you are always KEEN to do the activity you are good at, you are basically a pro at it.

Explanation:

A keen teacher and 'experience' are pretty relatable, the teacher is obviously very keen to teach something they have experience in, and experience is like for example a math teacher, who has lots of experience in math.

option one or two. let me know

Answers

Answer:

option 1 and i dont have no clue what u talking about

Explanation:

Answer:

if there are supposed to be pics, i dont see them

Explanation:

but i'll say option 2

PLS HELP ASAP!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Low, high, mysteriously, still and favorite

Ben’s Doggone Dog Blog

BEN: What’s the best way to get a pooch to behave? Reward him! (or her). Rewarding good behavior works better than punishing bad behavior (at least with dogs). Think about it. No one likes to be yelled at, and that includes canines! Dogs are a lot happier if their owner isn’t yelling “STOP BARKING!” My dog Yoda barks a lot. So what I do is this: If he stops barking when I ask him to, I make a little tiny clicking sound with a clicker (like a castanet) and give him a treat and say, “Good doggie.” This encourages him to behave.

COMMENT:
The clicking method doesn’t work in big cities. Where I live that tiny clicker would get drowned out by sirens and music blaring from cars. Also, giving dogs a lot of treats will make them gain too much weight.

Which is the counterargument?

The clicking method works only with small dogs.
The clicking method does not work in noisy places.
The clicking method hurts dogs’ ears.
The clicking method does not work with treats.

Answers

Answer: B.The clicking method does not work in noisy places.

Explanation:

I got it right on the test (edge 2021)

Answer:

I was doing the test and decided i would answer the answer is B The clicking method does not work in noisy places.

Explanation:

This is after I used process of elimination to rule out it was not a c or d

Part B
Remember what you have learned about the theme of struggling to find one's own identity and the key elements of a
story. Based on that information, write a 250-word fictional narrative about the Civil War from the perspective of the
character you have chosen. Your narrative should have a clear setting, a point of view, at least one character, and a plot.
Your narrative should also help explain the character's identity. Remember to stay true to what you have already learned
about the character you chose from "A Horseman in the Sky."

Answers

Answer:

Here are a few points you could include in your story if you chose Carter’s father:

Character: Carter’s father

Setting: his home in Virginia (and then later the hilltop in the battlefield)

Point of view: Here’s an example of the narrative from the first-person point of view:

A dagger sliced through my heart when my son told me he would betray our family legacy and join the Union army, but I steeled myself, and offered not the slightest hint of rage or disappointment.

why was the land at jamestown terrible?

Answers

Poor water quality almost destroyed the Jamestown colony. Most colonists were dead within two years. Between 1609 and 1610 the population dropped from 500 to 60, and the colony was nearly abandoned, an episode known as "starving time

B Read the sentences and complete them with the correct form of the verbs put, set or shake.
1 The university has
very high standards to attract the best students.
2 Don't
the blame on him. He's not the one responsible for the accident.
3lery
his head in disappointment.
4 She loved the house the minute she
eyes on it.
a lot of effort into repairing that old car.
6 Mrs Smith
her children the task of clearing out the attic.
7 After years of imprisonment, the man who had wrongfully been accused of the robbery was finally
8 They have announced their engagement but they haven't
a date for their wedding yet.​

Answers

Answer:

1. set

2.put

3. shake

4. set

5. put

6. set

7. put

8. set

Praise is nice. A raise would be nicer.
The most effective way to combine these sentences would be:

Answers

Answer:

To use a conjuction such as "but"

So it would read,

Praise is nice but a raise would be nicer.

CUI CU
complete each of the following statements with
the option that is most nearly opposite in
meaning to the word in CAPITAL LETTER
The tortoise has always been a FOOLISH
animal.
O
cunning
O
greedy​

Answers

Answer:

CUNNING IS THE RIGHT ANSWER .

1-Working as a waitress may not pay well, but …………………………….. the tips are good .
A- at a loss
B- at the risk
C- at a distance
D- at least

Answers

Answer:

I think option D - at least works right

Answer:

working as a waitress may not pay well,but at least the tips are good

"Someone had told them the best times to fish were at dawn and dusk, so they stayed out alone longer than they otherwise might have. It was getting dark when they saw four men in the distance, approaching along the beach. Nadia said they should go, and Saeed agreed, and the couple walked away quickly, but the men seemed to follow, and Saeed and Nadia increased their pace, increased it as much as they could manage, even though Nadia slipped and cut her arm on the rocks. The men were gaining on them, and Saeed and Nadia began to wonder aloud what of their things they could leave behind to lighten the load, or as an offering that might sate their pursuers. Saeed said perhaps the men wanted the rod, and this seemed more reassuring to them than the alternative, which was to consider what else the men might want. So they dropped the rod, but soon after they rounded a bend and saw a house and outside the house were uniformed guards, which meant the house contained a door to a desirable place, and Saeed and Nadia had never been relieved to see guards on the island, but they were now. They came close, until the guards shouted at them to stay back, and there Saeed and Nadia stopped, making it clear they would not try to rush the house, sitting down where the guards could see them, where they felt safe, and Saeed considered whether to run back and retrieve the rod, but Nadia said it was too risky. They both regretted dropping it now. They watched for a long while but the four men never appeared, and the two of them set up their tent right there, but were unable to sleep much that night." Explain what we learn from this scene using psychoanalytic lens.

Answers

Answer:

the scene is interesting but sorry i didnt understand what you are asking for

Explanation:

Tap the phrase that "they" refers to?
BRAINLIEST AND 30 POINTZ!!!!!!!!! :D

Answers

Answer:

the college students

Explanation:

they were to be honest with each other and themselves

Students who were asked to express their individual beliefs to peers who did not share same opinion.

Which text refers to an incident that occurred at a time before the setting of this story?
Kinsley stared at her reflection, noting the nose upturned too much, lips too thin, and wondered just how much hair one needed to cover
these ears. Clearly, much more than she had, Kinsley reasoned as she glided the comb through her brown tresses. How could her fraternal twin
sister be jealous of this mess? Kinsley sighed too loudly, and her bangs blew out of place and the tip of her ear emerged from her hair. Maybe
she should start wearing a hat.
Taking her phone, she turned her head and raised her chin, and snapped a selfie. Only seven selfies later, she took one that she deemed
"postable" and uploaded it to her social media page. She was getting better at this; the last one took no less than thirteen tries to get all her
disagreeable parts to appear inconspicuous enough to satisfy her discriminating eye. These ears were not going to humiliate her, and she was
certainly not going to give Megan Pendergrass an opportunity to mortify her again.
Meryl banged on the door, and before Kinsley could grant her permission or bar her from entering, she was breaking in and flopping onto
her bed.

Answers

She was certainly not going to give Megan Pendergrass an opportunity to mortify her again.

What is the passage within the literature?

A passage is honestly a component or section of written paintings, either fiction or non-fiction. Some hold that a passage can be as short as a sentence, however, a maximum encompasses a minimum of one paragraph and typically several.

What's a passage instance?

An example of passage is when you move on a ride and someone tells you to be safe in your travels. An instance of passage is when a vehicle moves thru a constrained area with permission. An example of passage is whilst time moves ahead.

Learn more about the passage here: brainly.com/question/26492392

#SPJ2

When my sister makes the salad, she ___________ the oil last..

add

adds

added

adding

Answers

i think the answer would be adds because it is present tense

1 someone shows signs of heat stroke and needs immediate emergency attention

Answers

Fever of 104 F (40 C) or greater.
Changes in mental status or behavior, such as confusion, agitation, slurred speech.
Hot, dry skin or heavy sweating.
Nausea and vomiting.
Flushed skin.
Rapid pulse.
Rapid breathing.
Headache. Unconsciousness for longer than a few seconds.
Convulsion (seizure).
Signs of moderate to severe difficulty breathing.
A rectal temperature over 40°C (104°F) after exposure to a hot environment.
Confusion, severe restlessness, aggressive behaviour or anxiety.

Please answer what you can:
Question 3
True or false? The converse of "Some medications are medications delivered
subcutaneously," is valid.
A)True
B)False
Question 4
The obverse of "Some medications are medications delivered subcutaneously," is.
A)Some medications are not non-medications delivered subcutaneously
B)All medications are medications delivered non-subcutaneously
C)No medications are medications delivered subcutaneously
D)Some medications are not medications delivered subcutaneously
Question 5
On the Traditional (Aristotelian) interpretation of the Square of Opposition, a false l-
proposition yields
A)a false A-proposition
B)a false E-proposition
C)a false 0-proposition
D)a true A proposition

Answers

Hepatitis about the disease is involved intolerant and sick

Hepatitis about the disease is involved intolerant and sick

Read this excerpt from Oliver Twist by Charles Dickens, and identify the meaning of the words in bold based on their context.

Answers

Answer:

If i see the text i might be able to help!

Answer:

cogitating → contemplatingcudgelling → beatingregaled → rewarded

Explanation: PLATO's "Pretest: The Victorian Era" on Edmentum

100 points! After reading the topic question and the evidence provided below, you will organize an argument. Remember: Write in complete sentences Write in the third person point of view Do not use feelings or emotions You will not be writing a complete argumentative essay. Topic question: Should reality television shows be banned? Instructions: You will organize an argument against the televising of reality television shows. Read the evidence below and then organize your argument. ​

Answers

Not agreeing with their ban on Reality Shows:

Honestly, no. Why should they be banned, there is nothing wrong with them, sure there are a few misleading shows, but that doesn't mean to ban them all. They're sometimes entertaining and fun to watch, not to mention a lot of them could help someone in a tough situation. Who knows what could happen, reality shows are just another sneak peek of reality. There is no harm in something so simple and basic. If they don't like the concept of the show, then don't watch it, it's honestly that simple.

Agreeing with their ban on Reality Shows:

Yes, honestly it should be, looking back at it, reality shows are just a bunch of rich people wanting more money and fame. Who knows what they do for an actual living, not to mention look at how they're living. They are misleading for all ages. Kids will sometimes even look on television and see what they're doing, and maybe, just possibly the kids will look up to that and become exactly what the parents didn't want. They also should not be surprised, after all, look at these people. They do nothing but talk about their life, their love interest, their unwanted habits. Where is the content? Exactly, there is no content behind what they call "Reality Shows", it's just a bunch of money-seeking adults that can't find actual content.

Answer: The argument for why they shouldn't be banned

have you ever looked at it TV show did you liked and do you watch that continuously what is a band your favorite show just because of a little bit of misleading information would you be upset? Because I know I would because all of my favorite TV shows normally end at the fourth season for some odd reason it's because they banned the show because of misleading information but they only do it to reality shows so if you like reality shows that have fake information they will most likely be banned and I think that is inappropriate for the situation because Banning a TV show because of misleading information does it mean you should ban it you should just let it continue

The argument for why they shouldn't be banned

.

The argument why they should be banned

 Say your watch like a fishing TV show and say aught fake there's no way as soon as they cast it out 5 minutes almost exactly every single time they catch a fish, and they use fake bait that's what you think will that could be true and would you think they should be banned because honestly I would if you're getting out fake information then why would you keep it and say that their true sing fake information and pretending that it's true should be illegal misleading information shouldn't be legal. So if you're a cop, and you go to interrogate someone, and they give you fake information they could probably of God off of the fishing show or a reality show in type would you want that?

Define the following democratic principle.
Accountability

Answers

Answer: Political accountability is when a politician makes choices on behalf of the people and the people have the ability to reward or sanction the politician.

Hope this helps  

Accountability can be defined as an obligation of the government to be answerable and justifiable to the people (citizens).

What is democracy?

Democracy can be defined as a government of the people, by the people and for the people.

What is accountability?

Accountability can be defined as an obligation of the government to be answerable, objective, justifiable and an ability to take responsibility for their actions and inactions towards governing and managing the resources of a country.

Under democratic principle, accountability involves the process of being responsible for what they do and being able to give a satisfactory reason for doing them.

Read more on accountability here: https://brainly.com/question/980342

URGENT! pls help. and give a explanation pls. i

Answers

Answer:

A square, one side labeled as 48 inches, has a circle inside it. The circle touches all the sides of the square. The portion of the square outside the circle is shaded.

How many square inches of cloth are cut from the square?

(π = 3.14)

2

Explanation:

Other Questions
Brad found Middle C on the piano writerA) any note he wanted it to beB) to the left of the three black notes at the bottomC) to the left of the 2 black notes in the middleD) to the right of the 2 black notes in the middle Determine which equation has the same solutions as the given equation.x2 10x 11 = 0A. (x 10)2 = 36B. (x 5)2 = 36C. (x 5)2 = 21D. (x 10)2 = 21 if you subtract 17 from my number and multiply the difference by -6 the results is -138 what is Sarah's number Find the volume for the regular pyramid.6 cu. units12 cu. units4 cu. units What role does Janes ambiguous social position play in determining the conflict of her story? (its based on the book Jane eyre)I need this ASAP! DQuestion 2If a right triangle has side lengths 6, 6.7 and 3, which side is the hypotenuse?O 3O 6.7O 15.706 What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions.