What was the purpose of J. Edgar Hoover’s memo?

Answers

Answer 1

Answer:

"There is nothing further on the Oswald case except that he is dead."

FBI Director J. Edgar Hoover dictated that line in a memo he issued on Nov. 24, 1963, the day Jack Ruby killed Lee Harvey Oswald as the gunman was being transported to the Dallas County Jail after the assassination of President John F. Kennedy.

The memo is one of at least 52 records never previously made public that were included in the release Thursday of about 2,800 unredacted government documents related to Kennedy's murder in Dallas two days earlier. President Donald Trump approved withholding an undisclosed number of other documents pending a 180-day national security review.

Explanation:


Related Questions

In which region of Italy where would u find Trevi fountain

Answers

Answer:

Rome, Italy, which resides within the Lazio region

Explanation:

what is decolonization? (5 or more sentences required)

Answers

Answer:

Decolonization, process by which colonies become independent of the colonizing country. Decolonization was gradual and peaceful for some British colonies largely settled by expatriates but violent for others, where native rebellions were energized by nationalism. After World War II, European countries generally lacked the wealth and political support necessary to suppress faraway revolts; they also faced opposition from the new superpowers, the U.S. and the Soviet Union, both of which had taken positions against colonialism. Korea was freed in 1945 by Japan’s defeat in the war. The U.S. relinquished the Philippines in 1946. Britain left India in 1947, Palestine in 1948, and Egypt in 1956; it withdrew from Africa in the 1950s and ’60s, from various island protectorates in the 1970s and ’80s, and from Hong Kong in 1997. The French left Vietnam in 1954 and gave up its North African colonies by 1962. Portugal gave up its African colonies in the 1970s; Macau was returned to the Chinese in 1999.

Explanation:

You're welcome :)

13. Which of the following statements about the Byzantine Empire is true?
O A. The Byzantine Empire helped to reunite the Eastern Orthodox and Roman Catholic Churches.
O B. The Byzantine Empire was able to restore the old Roman Empire.
O C. The Byzantine Empire helped preserve ancient Greek culture and literature.
O D. The Byzantine language, Greek, became the dominant language throughout Europe.

Answers

Answer:

c i think

Explanation:

The statement that is true about Byzantine Empire is the Byzantine Empire helped preserve ancient Greek culture and literature. Thus the option (C) is correct.

What was Byzantine Empire?

Byzantine Empire was one of the long lasting empire of the medieval age which was founded in 330 AD and continued till 1453. It was eastern half of the roman empire with the Greek origins.

They preserved the Greek and the Roman literature by studying them. They also saved the literature of the philosopher such as Plato and Aristotle and few of the Homer.

Thus the option (C) is correct.

Learn more about Byzantine Empire here;

https://brainly.com/question/18205624

#SPJ1

Can yall help me please

Answers

Answer:

agree

Explanation:

I believe when people go to vote they usually already know who they will vote for

Which of these describes the Silk Road? (4 points)
A. a series of land and water routes traders followed to get to the Middle East and Europe

B. a single path a Chinese trader followed to reach India and Arabia

C. a combination of sea and land routes that led from Beijing to the Himalayas

D. a route from central China to the Middle East that enabled exchange of goods and ideas

Answers

If I remember good I’m pretty the answer is a

Identify which European nations were successful in trading with Japan before the 1800’s.

Answers

Answer: The Dutch were the only one's successful in trading with Japan until the 1800's.

Explanation: :)

5. When a firm decides on the right mix of capital and labor to use, which of the three

basic economic questions does it answer? *

O

How to produce goods and services?

O

Where to produce goods and services?

O

When to produce goods and services?

O

What to produce?

Answers

Explanation:

The three  basic economic questions does it answer are -

How to produce goods and services?

Where to produce goods and services?

What to produce?

At the beginning of the 21st century, what caused U.S. foreign policy to shift toward the War on Terror?

Answers

War on terrorism, term used to describe the American-led global counterterrorism campaign launched in response to the terrorist attacks of September 11, 2001. ...

Describe HOW the election of 1828 changed American politics, what was different about this election from the election of 1824.

Answers

Answer:

Explanation:

-"The election of 1828 was a rematch between the incumbent president, John Quincy Adams, and the runner-up in the 1824 election, Andrew Jackson. ... Jackson won an overwhelming victory over Adams, capturing 56 percent of the popular vote and 68 percent of the electoral vote and bringing the Democratic Party into power."-"John Quincy Adams defeated Andrew Jackson in 1824 by garnering more electoral votes through the House of Representatives, even though Jackson originally received more popular and electoral votes. The presidential election of 1824 represents a watershed in American politics. ... But John Quincy Adams became president."

PLEASE HELP ASAP! ILL MARK BRAINLIST
Stephen Douglas would most likely support which statement?
A. slavery goes against the American ideal that all men are created equal.
B. conflicts between states will become worse unless slavery stop spreading.
C. The federal government should not influence states decisions about slavery.
D. States that oppose slavery should be forced to leave the United States.

Answers

Answer:

Stephen Douglas would more rather say either answer A or C. But I would more lean toward choosing answer C.

Explanation:

Stephen Douglas was a former US senator and belonged to the democratic party. The democrats believe in Personal and state rights. This includes that the government shouldn't influence state decisions in any way. Basically saying that the states should be able to figure it out themselves without government intrusion.

For that, I would choose answer C instead of A.

Answer:

Your correct answer with proof would be C. Plz mark brainliest.

Explanation:

How many people were killed hiroshima and nagasaki

Answers

Answer:

How many people died as a result of the atomic bombings of Hiroshima and Nagasaki? There is one thing that everyone who has tackled this question has agreed upon: The answer is probably fundamentally unknowable. The indiscriminate damage inflicted upon the cities, coupled with the existing disruptions of the wartime Japanese home front, means that any precise reckoning is never going to be achieved.

But beginning in 1945, people have tried to estimate the number of the dead and injured. The casualties from the first atomic bombings are not of mere historical interest. They are part of how we understand the effects of nuclear weapons today — for Hiroshima and Nagasaki, thankfully, remain the only instances of these weapons being used in warfare, and thus provide an invaluable “data set” upon which to base other understandings and simulations. The estimated casualties also play a nuanced role in the various narratives and arguments about the end of World War II.

How many died?

The most credible estimates cluster around a “low” of 110,000 mortalities and a “high” of 210,000, an enormous gap. (The estimates for each city have a range of ±10,000.)

There is no evidence that either of these estimates was made inaccurately or dishonestly, but they come from different sources and eras.

70.000 at Hiroshima ± 40.000 at Nagasaki

Explanation:

I hope this helps!

No Copy Paste

PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!!PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!!! PLSSS HELPPPP I WILLL GIVE YOU BRAINLIEST!!!!
"For evil to flourish, it only requires good men to do nothing."- Simon Wiesenthal

Simon Wiesenthal is a holocaust surviver. Although many different variations of this quote exists, this provides us a more haunting view of the world. Explain what this quote means. Explain if you agree or disagree with this quote. Finally, explain if you think it is difficult for "good men" to speak up of out? This should be in 3-5 sentences

Answers

Answer:

Explanation:

I agree because as it say for evil to FLOURISH it only requires the GOOD people to do NOTHING and the good people stop the bad people so If the good people stop helping defeat the bad people then the bad people with continue and no one will help

What made the great plains environment challenging for early American Indians?

A. Rocky Soil
B.Cold Winters
C.thick forests
D.a long coastline

The actual answer is : B

Answers

The Cold Winters made the great plains environment challenging for the early American Indians.

Help me Im timed, what is a wide gap in the wind river range of the Rocky Mountains called? ( 9 letter word)

Answers

Answer: South pass is the wide gap in the Wind River Range of the Rocky Mountains.

Explanation:

When did hom0 sapiens first appear on Earth?
200,000 years ago
2 million years ago
2,000 years ago
2 million years ago

Answers

Answer:

200000 years ago

Explanation:

thats when they showed up

How did World War I affect the economy of the United States?
A
It helped the country become the strongest industrial power in the world.
B
It hurt the economy because the government regulated industry.
С
Many men could not find jobs when they returned from the war.
D
It was a good time for farmers, but there was little effect on manufacturing.

Answers

Answer:

Economic Impact on the United States. World War I took the United States out of a recession into a 44-month economic boom. ... U.S. exports to Europe increased as those countries geared up for war. Later, U.S. spending increased as it prepared to enter the war itself.Explanation:

i believe the answer is d. sorry if it is wrong

write a 2 paragraph summary report detailing the reasons why the U.S.
were unprepared for an attack on Pearl HarboR

Answers

Since the United States was not engaged in an armed battle at the time of the assault on Pearl Harbor, arms and other supplies were not available 24 hours a day, seven days a week. In reality, most of the equipment on the ships, as well as in the barracks and air stations, was only ready for inspection on the morning of the Pearl Harbor attack, and most ammunition was locked away.

Be it enacted by the Senate and House of Representatives of the United States of America in Congress assembled, That the tract
of land in the Territories of Montana and Wyoming, lying near the head waters of the Yellowstone river, ...is hereby reserved and
withdrawn from settlement, occupancy, or sale under the laws of the United States, and dedicated and set apart as a public park
or pleasuring ground for the benefit and enjoyment of the people.
- From An Act to set apart a certain Tract of Land lying near the Head-waters of the Yellowstone River as a public Park, 1872
The Conservationist Movement of the 19th Century came up against the Preservationist Movement. What conflict did the
Preservationist have against acts such as Yellowstone being set aside as a public park?
es )
A)
Preservationsits did not want land protected but preserved for the native
inhabitants, usually native Americans, for living purposes.
B)
Preservationists wanted lands such as Yellowstone to be left in pristine
condition and not open to public use and economic opportunity.
Preservationists did not want lands such as Yellowstone to be protected by
law or the government and left open to all people for any use.
D)
Preservationsits wanted lands such as Yellowstone to be open for any
development for public use, with all resources preserved for economic use.
Progressive Movement
My

Answers

I think the answer is C try it

Slavery in North America:Question 2
Which statement about the majority of enslaved people during
the 1800s is true?
Select one:
A.)
They practiced strictly African religions.
B.)
They had legal rights in court.
C.)
They were trained in skilled labor.
D.)
They were engaged in urban industries.
E.)
They lived on large Southern plantations.

Answers

Answer : E


Explanation :

How far south where the South Korean forces pushed by the North Koreans?

Inchon

Pusan

Panmunjon

Wake Island

Answers

Answer:

The North Korean occupation of South Korea from June to September, 1950 constituted the first phase of the Korean War. On June 25, 1950, The Korean People's Army (KPA) crossed the 38th parallel between North and South Korea. The KPA advanced at incredible speed, capturing Seoul on June 28, 1950. Thus began the three-month North Korean occupation of South Korea.

Explanation:

Pusan is the right answer

What is one of the biggest criticisms of the USA PATRIOT Act?

Answers

Answer:

QUESTION:

What is one of the biggest criticisms of the USA PATRIOT Act?

ANSWER:

It is weakening the protection of civil liberties.

Explanation:

Hope that this helps you out! :)        

If you have any questions please put them in the comment section below this answer.        

Have a great rest of your day/night!        

Please thank me on my profile if this answer has helped you.  



Definition: This tax can be levied by any county for the purpose of funding the building and maintenance

of parks, schools, roads, and other public facilities.

Example: The Special Purpose Local Option Sales Tax adds an additional 2% onto the existing state sales

tax of 4%

Answers

Answer:

The answer is "SPLOST".

Explanation:

A central tax rate with special purposes can support capital expenditure projects in Georgia. Its optional tax rate for parks, schools, highways as well as other government infrastructure levied by every jurisdiction is a 1% tax. The electorate shall decide if the projects described are financed via SPLOST or government leaders are not required to raise property tax for funded projects.

can someone help me and I will give you brainly ​

Answers

Answer:

B.

Explanation:

Edward Jenner, Isaac Newton, Tycho Brahe, and Johannes Kepler are all associated with the:
A. Enlightenment
B. American revolution
C. Scientific revolution
D. Colonization of the americas

Answers

The answer is B American revolution



President James Monroe's 1823 announcement that the Western Hemisphere was not open to European Colonization is
called the

Answers

Answer:

Monroe Doctrine

Explanation:

The Monroe Doctrine

Answer:

The Monroe Doctrine is the best known U.S. policy toward the Western Hemisphere. Buried in a routine annual message delivered to Congress by President James Monroe in December 1823, the doctrine warns European nations that the United States would not tolerate further colonization or puppet monarchs.

Could you please help me with the two most recent questions of mine on my page? I will give u brainliest and 20 points! :))) X

True or False: Buddhism can be considered a way of life.

Answers

Answer:

True

Explanation:

The U.S. government tries to improve the country's economic growth by:
A. increasing inflation levels,
B. creating a command economy
C. changing income tax rates,
D. setting its unemployment rate.

Answers

Answer:

c

Explanation:

How were farmers given an opportunity to own a farm in Bosque Farms after the Dust Bowl?

And please don't answer with a link thank you.

Answers

Answer:

The Bosque Farm Project helped farmers in New Mexico by giving farmers an opportunity to own a farm in Bosque Farms after the Dust Bowl by winning a public lottery that was held in 1935.

Help:

Could you please help me with the two post recent questions of mine on my page? I will give u brainliest and 20 points! :))) X

HELP! ILL MARK BRAINLIEST! Bellwork Unit 5 - Day 5: Write a diary entry as if you were a imperial power attempting to colonize a foreign land. Explain your reasons for choosing that location (economic, political, social, etc.). Would you have direct or indirect rule and why?​

Answers

Answer:

As Europeans moved beyond exploration and into colonization of the Americas, they brought changes to virtually every aspect of the land and its people, from trade and hunting to warfare and personal property. European goods, ideas, and diseases shaped the changing continent.

As Europeans established their colonies, their societies also became segmented and divided along religious and rac.ial lines. Most people in these societies were not free; they labored as servants or slaves, doing the work required to produce wealth for others. By 1700, the American continent had become a place of stark contrasts between slavery and freedom, between the haves and the have-nots.

Why did the Constitution's framers give the Senate a shared role with the president in making treaties?

Answers

Answer:

To balance the power and to approve with objective conditions or reservation or disapprove entirely.

Explanation:

The Constitution's framers give the Senate a shared role with the United States President in making treaties simply because they felt that the Senate, which is comprised of an equal number of representatives from each state will have the opportunity to balance the power and to approve treaties with objective conditions or reservation or disapprove entirely.

Other Questions
What is equivalent to x+y+x+y+3(y+5)? explain the major resources of energy and write its impoetance What is the fraction equivalent of 430%NO LINKS. IF WRONG I WILL DELETE. I need this plz help In romeo and juliet passage 1 line 64, what does the phrase, content thee most closely mean?A. Be satisfiedB. Be rationalC. Be stillD. Be grateful Diego bought some raisins and walnuts to make trailmix. Raisins cost $4 a pound and walnuts cost $8 apound. Diego spent $15 on both ingredients. Decide ifeach pair of values could be a combination of raisinsand walnuts that Diego bought.Explain your answer. HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes. Which states the best reason why Chapter 15 might be titled "Nest-Building"?The robin is building a nest in the garden.A nest is a symbol for a safe place where Mary and Colin can grow.The robins are a symbol for new life returning to the garden.Mary and Dickon want Colin to watch the robin building the nest. You estimate that there are 40 marbles in a jar. The actual amount is48 marbles. Find the percent error. Round to the nearest tenth of a percent. help me plz which formula should I use?? What is the pear harbor and what happened 1. When did Texas become a territory of the United States? 5 oranges are bought for $4.00 and later sold at $0.10 each .find the loss percent. What is an advantage to being ectothermic?Question 18 options:Ectothermic animals require much less energy to survive than endothermic animals. Ectothermic animals can sleep longer than endothermic animals. Ectothermic animals always live longer than endothermic animals. Ectothermic animals can live in a greater number of environments than endothermic animals.