what happened to the location of an object while they are in motion

Answers

Answer 1

Answer:

Location changes

Explanation:

The location of an object changes when in motion.

One can tell there is motion when the location of a particular body is changing constantly. Motion can be about a fixed point, along a line or even in rotational sequence.

Motion occurs when force is applied on a body and acceleration happens.

The most underlining fact is that the position of the body will keep changing from time to time.


Related Questions

Any two Features of mini steel plant.

Answers

Answer: Dependent on electric power and do not cause pollution mark me brainliest plz

Explanation:

Answer:

Explanation:

they use cheaply available scrap iron

they use electric furnaces therefor causing no pollution

Describe the difference between a perfect circle and an ellipse

Answers

Answer: A circle is a closed curved shape that is flat. Instead of having all points the same distance from the center point, though, an ellipse is shaped so that when you add together the distances from two points inside the ellipse called they always add up to the same number.

PLEASE ANSWER THIS!!!!!?
Please select the word from the list that best fits the definition

measures air pressure
barometer, radar, statellites, thermometer, anemometer, weather vane

Answers

Answer:Barometer  

Explanation:

Answer:

A. Barometer

Explanation:

I got it right on the test

Briefly explain why obedience to the Roman Catholic pope was judged to be evidence of obedience to government rulers during Spanish domination of Latin America

Answers

Answer:

The Roman Catholic Pope and the governments that were allies had close ties and worked together for mutual interest.

Explanation:

During the period of colonization, the government rulers of Spain and the Roman Catholic Pope had very close ties. They basically collaborated and in many ways worked together for mutual interest. The mutual interest was basically to retain power and keep the obedience of the masses for that purpose.

If the people were obeying the Roman Catholic Pope, and the majority did, it was not just seen as a religious thing, but also as a political one. Automatically, the rulers of the Spanish empire accepted this as the people obeying them. While this may seem strange, it is not really, since the rulers of Spain had a big influence on the Pope and protected him, while the Pope was doing a double job, political and religious, in keeping people at peace.

You are the prime minister of your country . Explain how would you use the land that is accessible . What policies will you take to ensure land is not abused.

Answers

Answer:

The free land should be used to build houses and small apartments building. These apartments should be offered to homeless people who can rent out these apartment or buy these apartment at very nominal prices.

Explanation:

The free lands should be used by government to make apartments for homeless people. There should be shops built near these apartment where the government sets up shops and then the unemployed people are given these shops for rent free to run their business and earn their livelihood.

the rule when doing a military grid is​

Answers

Answer:

Always read to the RIGHT and then UP.

Explanation:

The first half of the reported set of coordinate digits represents the left-to-right grid label, and the second half represents the label as read from the bottom to top.

Which branch of government has the power to create laws?

A. Executive
B. Legislative
C. Judicial
D. Supreme​

Answers

Answer:

C is the answer

Explanation:

because its C

Answer:

actually its legislative

Explanation:

Legislative—Makes laws

google said so

What is capital of USA?

Answers

Answer:

Washington D.C.

Explanation:

You should know this

Answer:

Washington, DC

If rain was approaching, what would be some of the observations that you might make?

Question 13 options:

falling barometer, increased cloudiness, rising temperatures


rising barometer, increased cloudiness, rising temperatures


rising barometer, decreased cloudiness, falling temperatures


falling barometer, increased cloudiness, falling temperatures

Answers

Answer:

D

Explanation:

I hoped this help u have a great day

What is a "Climate system"?

Pls help and if you can explain

Answers

Answer:

Earth's climate arises from the interaction of five major climate system components: the atmosphere, the hydrosphere, the cryosphere, the lithosphere and the biosphere.

Explanation:

PLS HELP, WILL REWARD BRAINLIEST ASAP!!


(!!!) just an fyi, im not giving brainliest to those who get it off the internet. if u do so I will unfortunately delete your answer.

Answers

Answer: I think it’s the Venezuela population?

Explanation:

HELP HELP HELP!!! Idk about this. This is science

Answers

Answer:

the same volume but different shape

Explanation:

the same value but a different shape

Why was aid and relief to drought-affected areas of Somalia slow to reach people in need in 2001?
A.
Troops from Ethiopia intercepted the goods for their own starving population.
B.
Civil wars and warlords slowed the movement of food and supplies.
C.
The UN scaled back its forces after the head of the Development Programme was killed.
D.
A tsunami off the coast limited access by sea, which made shipping the supplies challenging.

Answers

The answer is B I got it off the internet

The correct option is B.

Civil wars and warlords slowed the movement of food and supplies.

What are the effects of drought in Somalia?

The drought has caused large-scale crop failures and livestock deaths, impacting livelihoods and food supply. This shock is taking place in an existing fragile conflict environment with high levels of poverty, widespread water shortages, food insecurity, displacement, and deep communal tensions.

How long did the drought in Somalia last?

Somalia experienced three major drought crises in this decade: In 2011-12, 2016-2017, and now in 2021-22. In the 2011-12 drought crisis, when the UN declared a famine in Somalia, 3.7 million people experienced crisis levels of food insecurity.

Learn more about drought in Somalia here https://brainly.com/question/1359783

#SPJ2

1and 2 are vertical angles. If the

measure of 2 is 105°, find the measure of1.

Answers

Answer:

vertical angles are congruent so angle one is 105

Explanation:

How many different types of species does the rainforest have?

Answers

Answer:

Between 20 Million to 40 Million

While I was researching, a scientist

said that he estimates that there are about 20 to 40 million species.

Hope this helps! <3

Answer:

estimated between 3-50 million

Which of the following best completes this title?
O Climate Distribution
O Deforestation
O Creation of Dams
O Categorizing Areas into Regions

Answers

The answer is CLIMATE DISTRIBUTION

Point N is on line segment \overline{MO} MO . Given MN=2x,MN=2x, NO=x-2,NO=x−2, and MO=2x+9,MO=2x+9, determine the numerical length of \overline{MN}. MN

Answers

Answer:

MN = 22

Explanation:

Given that,

Point N is on line segment MO. MN = 2x, NO = x-2 and MO = 2x+9

ATQ,

MO = NO + MN

Putting all the values,

2x+9=x-2+2x

2x+9=3x-2

Taking like terms together,

2x-3x=-9-2

-x=-11

or

x = 11

Since, MN = 2x

= 2(11)

=22

So, the length of MN is 22 units.

What two things slow alligator and crocodiles down on land

Answers

Answer:

heavy bodies and slow metabolism

Explanation:

Answer:

They are heavy and have smaller feet. They are pretty fast on land. They can barrel roll which can kill you instantly. Some people say if one chases you on land then you can run in a zig zag and you could probaly escape.

Explanation:

I need help !!!!
Match the description in column 1 with the religion in column 2.
Founded by
Muhammad
?
Buddhism
Founded by the
Aryan people
2
Chinese folk religion
A mixture of
Buddhism,
Taoism, and
Confucianism
?
Islam
< PREVIOUS

Answers

Explanation:

full picture for question

Answer: Founded by Muhammad = Islam

Founded by the Aryan people = Hinduism

A mixture ofBuddhism, Taoism, and Confucianism = Chinese folk religion

Founded by a Hindu prince = Buddhism

Explanation:

Many more earthquakes occur along the San Andreas Fault in California than in other parts of the United States. Scientists claim that these earthquakes are caused by activity along a transform plate boundary.

Answers

Answer:

Many more earthquakes occur along the San Andreas Fault in California than in other parts of the United States. Scientists claim that these earthquakes are caused by activity along a transform plate boundary

Explanation:

Answer: C

Explanation: plates slip past each other at the boundary

Read the passage below and use the information to answer the question that follows.

Ferdinand Magellan, a Portuguese navigator and sailor who sailed for Spain, was the first European to find a waterway between the Atlantic and Pacific oceans, and sail across the Pacific. He was the first person to lead a voyage completely around the world, proving that the Earth is round.

In September 1519, Magellan left from southwestern Spain in command of five ships and a crew of over 250. The expedition sailed across the Atlantic and down the eastern coast of South America. As they sailed, they explored large rivers looking for the waterway that would connect them to the Pacific. When cold weather and winter storms forced them to camp near the southern tip of the continent, Magellan had serious problems to contend with. One of his ships was destroyed while exploring the area. A group of sailors unhappy with the length and danger of the trip attempted to take control of the expedition and return to Spain. Magellan put down this mutiny attempt by force, beheading the leader and leaving other members of the mutiny behind when the expedition continued.

In October 1520, over a year after leaving Spain, they discovered the passage to the Pacific—a passage now called the Strait of Magellan. It took over a month to sail through the narrow, cold, stormy strait. During the passage through the strait one of Magellan’s ships deserted and returned to Spain. On November 28, the three remaining ships sailed out of the strait and into the ocean. Magellan named the ocean Pacifico (Pacific) which means peaceful because, compared to the tumultuous strait they had just been through, the ocean was amazingly calm.

Since no European had previously crossed the Pacific, Earth’s largest stretch of ocean, Magellan and his crew had no idea how big it was and how long it would be before they would again see land. As they sailed month after month, their situation became desperate. Much of the crew became sick from scurvy, a disease caused by lack of vitamin C. Food supplies were not adequate for such a long voyage and those who not killed by scurvy were reduced to eating rats, shoe leather, and sawdust to survive.

After over three months of sailing, Magellan’s expedition arrived in the islands now known as the Philippines. In the several weeks they stayed in the Philippines to recover Magellan and members of his crew became close to the islanders. Magellan converted some to Christianity. In April 1521 Magellan was killed while participating in a battle between rival groups on the island of Mactan.

Based on the passage above, what does circumnavigate mean?
A.
pass over
B.
explore
C.
sail around
D.
investigate

Please select the best answer from the choices provided
A
B
C
D

Answers

Answer:

C

circum is basically circle and navigate is obvious

sailing around is best choice

Based on the given passage above, circumnavigate means to sail around. Hence, option C is correct.

What does Magellan Expedition mean?

The Magellan expedition, often called, was a Spanish expedition initially led by Portuguese explorer Ferdinand Magellan to the Moluccas, an Indonesian island that departed from Spain in 1519, and culminated with the first circumnavigation of the world in 1521 until his death.

Magellan wanted to reach South-East Asia, where a number of spices grew and gems were to be found, by sailing westwards across the Atlantic Ocean. He hoped to find a passage through South America so that he could sail all the way from the Atlantic Ocean to the ocean beyond the Americas, now known as the Pacific Ocean.

Magellan wanted to reach South-East Asia, where a number of spices grew and gems were to be found, by sailing westwards across the Atlantic Ocean. Therefore, based on the given passage above, circumnavigate means to sail around. Hence, option C is correct.

Learn more about Magellan expeditions here:

https://brainly.com/question/7067133

#SPJ2

What creates regional climates?

Answers

Answer:

The weather you encounter day to day depends on where you live. Places around the Equator experience warm weather all year round, but experience alternate periods of rainy and dry seasons. Places near lakes may experience more snow in the winter, whereas places on continental plains may be more prone to hail, thunderstorms, and tornados in the summer. The different kinds of weather you might experience in these regions are caused by moving patterns in the Earth’s atmospheric and oceanic circulation, unequal heating of the Earth, and the rotation of the Earth on its tilted axis.

Explanation:

Answer: They are caused by moving patterns in the Earth's atmospheric and oceanic circulation, unequal heating of the Earth, and the rotation of the Earth on its tilted axis. ...

Explanation:

If Adrian needed to be at his grandmother's house in 3 hours and it was 150 miles away, at what speed would he need to drive to get there?
A.0.02 miles/hour
B.50 miles/hour
C.450 miles/hour
D.60 miles/hour

Answers

Answer:

50 miles/hour

Explanation:

150 divided by 3 = 50

If Adrian needed to be at his grandmother's house in 3 hours and it was 150 miles away, he has to travel at the speed of 50 miles/hour drive to get there. Thus the correct option is B.

What is speed?

Speed refers to the rate of movement of an object along the path in time. The proportion of an object's length traveled to its journey time.

The first person to calculate speed by allowing for both the distance traveled and the amount of time required was the Italian mathematician Galileo Galilei. He described speed as the amount of distance travelled in a given amount of time.

To calculate  the speed  the formula will be

Distance= 150 miles away

Time= 3 hours

Speed= Distance / Time

Speed= 150 / 3 hours

Speed= 50 miles per hour

Therefore, option  B 50 miles/hour is appropriate.

Learn more about Speed, here:

https://brainly.com/question/28224010

#SPJ2

Which one?
A. B. C. or D? ​

Answers

Answer:

I belive it is A. Correct me if im wrong.

Explanation:

01
Questions
Question 1 of 1
Which of the following is a fall prevention system?
A-Personal fall arrest system
B-Safety net system
©
C-Guardrail
D-Top rail

Answers

A is the answer I think

Read the passage below and use the information to answer the question that follows.

Ferdinand Magellan, a Portuguese navigator and sailor who sailed for Spain, was the first European to find a waterway between the Atlantic and Pacific oceans, and sail across the Pacific. He was the first person to lead a voyage completely around the world, proving that the Earth is round.

In September 1519, Magellan left from southwestern Spain in command of five ships and a crew of over 250. The expedition sailed across the Atlantic and down the eastern coast of South America. As they sailed, they explored large rivers looking for the waterway that would connect them to the Pacific. When cold weather and winter storms forced them to camp near the southern tip of the continent, Magellan had serious problems to contend with. One of his ships was destroyed while exploring the area. A group of sailors unhappy with the length and danger of the trip attempted to take control of the expedition and return to Spain. Magellan put down this mutiny attempt by force, beheading the leader and leaving other members of the mutiny behind when the expedition continued.

In October 1520, over a year after leaving Spain, they discovered the passage to the Pacific—a passage now called the Strait of Magellan. It took over a month to sail through the narrow, cold, stormy strait. During the passage through the strait one of Magellan’s ships deserted and returned to Spain. On November 28, the three remaining ships sailed out of the strait and into the ocean. Magellan named the ocean Pacifico (Pacific) which means peaceful because, compared to the tumultuous strait they had just been through, the ocean was amazingly calm.

Since no European had previously crossed the Pacific, Earth’s largest stretch of ocean, Magellan and his crew had no idea how big it was and how long it would be before they would again see land. As they sailed month after month, their situation became desperate. Much of the crew became sick from scurvy, a disease caused by lack of vitamin C. Food supplies were not adequate for such a long voyage and those who not killed by scurvy were reduced to eating rats, shoe leather, and sawdust to survive.

After over three months of sailing, Magellan’s expedition arrived in the islands now known as the Philippines. In the several weeks they stayed in the Philippines to recover Magellan and members of his crew became close to the islanders. Magellan converted some to Christianity. In April 1521 Magellan was killed while participating in a battle between rival groups on the island of Mactan.


As you read, Magellan himself did not make it all the way back to Spain. The ship that returned to Spain was captained by Juan Sebastián del Cano, who made the entire voyage. Del Cano was honored at the time for this accomplishment, yet today few know his name. It is Magellan who is famous and who is honored for the first voyage around the world. According to what you read, why do you think this is so?

A.
Magellan’s family did a skillful job of discrediting Juan Sebastián del Cano and returning the spotlight to Magellan himself.
B.
Magellan had the complete confidence of by his crew and was an excellent navigator who had planned a journey with little risk until the very end.
C.
Magellan, realizing that he might not make it the whole way, had created a route that his sailors could use to find the Spice Islands, bargain for valuable spices there, and return to Spain.
D.
Magellan took the risk of leading the voyage, was the first to find and pass through a waterway between the Atlantic and Pacific, and brought his crew across the unknown Pacific to land.

Please select the best answer from the choices provided
A
B
C
D

Answers

Answer:

B

Explanation:

Do you think you Can shorten the answer

Where is the energy for cell division generated?

nucleus
chromatin
mitochondria
endoplasmic reticulum

Answers

Answer:

mitochondria

Explanation:

because of the mitochondria is the most important thing in lifetime.

Answer:

Mitochondria

Explanation:

The mitochondria are the cell's power plant, the nucleus is the command center, and  the endoplasmic reticulum (ER) is the cell's factory.

Hope this helped!

Question 2 (1 point)
Early cultural hearths are where people met to exchange goods and ideas that spread throughout the world
True
False
Is it true

Answers

Answer:

The statement is false.

Explanation:

Early cultural hearths are the places where the first civilizations developed. These places provided the best conditions for people to be able to engage in large-scale agriculture. With the production of a surplus of food, the people in these areas had spear time, enabling them to engage in other things and specialize, thus gradually setting up the foundations of the first civilizations.

Such places were the biggest river valleys where the climate was warm or temperate. The river valleys of the Nile, Tigris and Euphrates, Yangtze, and Indus, gave rise to the ancient Egyptian, Sumerian, Chinese, and Hindu cultures. While these cultures did not have a global impact, they did manage to give a lot to the people in the surrounding areas, which later they used for their own development and prosperity.

what happened to the temperature and pressure if the rock burned down deep
A.it increases
B. it decreases
C.it remains the same
D.it is intermittently degrading ​

Answers

I think you meant to say buried. I’m that case the answer should be a
The answer is a I’m pretty sure

8. Skew lines intersect.*
Sometimes
Always
Never

Answers

I believe it’s never because from what I found out is that Skew lines do not intersect.
Other Questions
Lee's uncle is installing a new pool in his backyard. The pool is a square and has an area of 121ft^2. He decides to build a 4 ft wide deck to surround the pool. What is the outside perimeter of the deck? The small square is the pool and the deck is the big square Eukaryotic cells are differentiated from prokaryotic cellsbecause eukaryotic cells what is the value of y in the proportion? How many kilograms do you have with 100g of tortillas similarities between the Texas Declaration of Independence and the United States Declaration of Independence. PLEASEEE HELPPPPConsider the equation:4A1+302 - 2Al2O3Is this equation balanced? Why or why not? The concepts listed above were included in the United States Constitution in order to- limit the powers of government limit the powers of government copy the British system of government copy the British system of government establish a strong militia establish a strong militia put down rebellion in the western territories put down rebellion in the western territories Which actions by the British Parliament provoked the American colonies to revolt? how to say good day in spanish Which of the following is acomplete sentence?A. Since you are my friend, I feel it is safe toconfide in you.B. Although they didn't know what would comeout of that dark, forbidden looking cave in frontof them.C. Because she had cared so paitiently for thelittle crippled dog, and the bird with the brokenwing. Digest the sequences using Haelll. Person 1 GGCCTCGGCCTAGAACGGCCTAGCCG CCGGAGCCGGATCTTGCCGGATCGGC Person 2 CTGAGGCCTAAGCGATTCCCGGATATA GACTCCGGATTCGCTAAGGGCCTATAT Only these two questions, I need answers with proof! Use the diagram to answer the question. Fill in the blank for the letter given with the missing reason in the flow proof. Please help me out :( Which item is the best description of Susan b Anthony 6+(-5)+7-1A. 9 B. 7Which one? PLEASE HELP ME ASAP, THIS IS DUE TODAY AT 4:00!! Which term refers to the structure that forms the surface of a cell, separating its contents from the outside world?Question 6 options:mitochondriaendoplasmic reticulumplasma membranecapsule In a crowded and complex society, rights will clash. When that occurs in the legal environment of business, what might be expected to follow the correct anserw is basalt promise me i even looked this up:) draw the structure of a graphite help please and thank you