The National Voter Registration Act of 1993 is also known as which of the following?
Question 6 options:

a)

Motor Voter

b)

Voting Rights Act

c)

Interstate Voter Registration Crosscheck Program

d)

the voter's oath

Answers

Answer 1

The National Voter Registration Act of 1993 is also known as the motor voter. Option A is correct.

What is the National Voter Registration Act 1993?

It corresponds to a US federal law that aims to facilitate the request for registration to vote when voters request the renewal of their driver's license or identity, which is why it became known as the "Motor Voter" law.

Therefore, the law also acts as a measure to reduce the bureaucracy of the electoral register, greater accessibility and, consequently, greater attraction of citizens to become voters and participate in the electoral process in the country.

Find out more about National Voter Registration Act at:

https://brainly.com/question/19056154

#SPJ1


Related Questions

Using sunscreen to avoid skin cancer is an example of how a healthy choice can be seen as an…?
investment
annoyance
obligation
inconvenience

Answers

Answer:

obigation?

Explanation:

im mad confused

What did the three landmark 1969--1970 environmental laws that President Nixon signed do?

- They ended the practice of environmental impact reports for public projects.

- They set new pollution standards.

- They created a major federal agency for environmental issues.

- They abolished citizen suits against polluters.

Answers

- They set new pollution standards.
- They created a major federal agency for environmental issues.

The administration's most liberal policy decisions related to the environment. Mindful of rising public concern over public health hazards and long-term ecological deterioration, Nixon signed the National Environmental Policy Act (1969), the Clean Air Act Extension (1970), and the Environmental Protection Act (1970). Together, these landmark laws mandated environmental impact statements for public projects, set new pollution standards, authorized citizen suits against polluters, and created a major federal agency for environmental issues.

To protect against smaller-scale environmental dangers, Nixon also signed the Occupational Safety and Health Act (1970), which he called "one of the most important pieces of legislation ... ever passed by the Congress." Though some Republicans resented federal regulation of workplace conditions and the bureaucracy it created, occupational safety was a popular issue among workers a crucial segment of Nixon's new political coalition.

Using the graph shown below:
A) Evaluate [tex]f(c)[/tex].
B) Solve for [tex]x[/tex]. If [tex]f(x)=p[/tex], what is [tex]x[/tex]?
C) If [tex]f(b) = z[/tex], what is [tex]f(z)[/tex]?
D) What are the coordinates of points L and K?
D.1) What are the X and Y coordinates of point L?
D.2) What are the X and Y coordinates of point K?

Answers

The function f(c) when evaluated is f(c) = L and other functions are solved below

Evaluating f(c)

From the question, we have the following parameters that can be used in our computation:

The graph

On the graph, we have

f(c) = L

Solving for x

From the graph, we have

x = a when f(x) = p

Evaluating f(z)

From the graph, we have

f(b) = 0

This means that

z = 0

The coordinates of points L and K?

From the graph, the X and Y coordinates of point L are

x = c and y = t

From the graph, the X and Y coordinates of point K are

x = a and y = p

Read more about functions at

https://brainly.com/question/28532394

#SPJ1

The type of economy most closely associated with the United States is

Answers

Let us try to understand what the economy is about:- The study of economics is roughly divided into macroeconomics and microeconomics. today, the range of fields of study examining the economy revolves around the social science of economics, but may also include sociology, history, anthropology, and geography.

The united states have a mixed economy, exhibiting charecterstrisics of both capitalism and socialism. a mixed economy found in the U.S we find diverse economy such a mixed economy embraces the free market when it comes to capital use but it also allows for government intervention for the public good.

The U.S. government has always played a role in the economic affairs of the nation. over the course of history, many services began to come under the influence of direct technology.  the economic system in the U.S. is great for developing nations in a systematic manner.

to know about U.S economy :

https://brainly.com/question/14786578

3. What is one reason people were safer working in the fields as opposed to in towns?
A. The plague was more likely to occur in towns than in less crowded rural areas.
B. Troops took towns hostage and kicked people out of their homes.
C. Flagellants stayed in the towns and did not wander the countryside.
D. Manor lords were angry at serfs in the towns, but serfs in the fields could hide from them.​

Answers

answer is A!!!! i needs to have 20 characters soo

PLS HURRY TIMED!!! Which explains the relationship between phenomenology and reduction?


Reduction is used to refute the role of phenomenology.


Phenomenology requires more effort than reductionism.


Without reduction, phenomenology would not be possible.


Both aim to understand human existence.

Answers

The option that explains the relationship between phenomenology and reduction is that both aim to understand human existence. (Option D)

What is the Relationship between Phenomenology and Reduction?

The friendship between and reduction is complex and versatile. Both approaches aim to comprehend human life, but they do so indifferent habits.

Reductionism is a reflective approach that seeks to interpret complex phantasms by breaking ruling class unhappy into more natural elements. Reductionists argue that entirety maybe assumed in conditions of allure constituent parts and their interactions, what greater-level phantasms are eventually reducible to lower-level one.

Phenomenology, in another way, is a philosophical approach that focuses on the study of emotional knowledge. Phenomenologists inquire to specify the buildings and processes of consciousness and emotional occurrence, outside lowering ruling class to plainer components or expounding bureaucracy in conditions of latent material processes.

Learn more about phenomenology  here: https://brainly.com/question/31563430

#SPJ1

If a student were preparing a research paper on Louis XIV, would Bossuet’s writings be useful?

Answers

The answer to this question would be "Yes, Louis' reign was one of absolute rule based on Bossuet's justification of divine right."

What is Bossuet's justification of divine right?

Bossuet, a French theologian and scholar, asserted in his work "Politics according to the Holy Scriptures" that God directly handed authority to the King. As a result, the king is accountable to the god rather than his subjects.

Jacques-Benigne Bossuet (1627-1704) reinforced medieval concepts of kingship with his doctrine of the Divine Right of monarchs, which maintained that certain monarchs governed because God selected them to do so and that these kings were answerable to no one but God.

Learn more about Bossuet:
https://brainly.com/question/8303780
#SPJ1

Which statement is TRUE about Shays'
Rebellion?
A. The federal government decided to intervene.
B. The federal army was created to stop the rebellion.
C. The state was NOT able to gather together a militia
due to lack of funds.
D. The British army broke up the raid.

Answers

Answer:

C. The state was NOT able to gather together a militia due to lack of funds.

Explanation:

Hope this helps:)

why is it difficult to grow quinoa (disincentives) and the incentives for growing other crops list three for each.

Answers

Pests found in quinoa farming include the tarnished plant bug, stem borer, flea beetles, aphids, leafhoppers, and beet armyworm.

What are the disadvantages of this plant?

Even in this case, however, there is a disadvantage. Quinoa, in fact, contains a number of irritant toxic compounds for the intestines that can cause inflammation, digestive issues, and nutrient absorption problems. Too much quinoa on your plate can cause stomach pain, diarrhoea, bloating, and discomfort. This occurs because your body cannot handle an excessive amount of fibre. It also contains saponins, a naturally occurring chemical that can cause stomach problems if quinoa is not thoroughly washed.

To know about Quinoa visit:

https://brainly.com/question/30440857

#SPJ1

!HELP QUICKLY PLEASE! 10+ POINTS AND WILL MARK BRAINIEST!
1. Choose a country you would want to do business with.
2. Define and interpret 4 of Hofstede's dimensions and how they impact the way business is done in the country you chose.

Answers

1. The country I have chosen for this assignment is Japan.

2. Hofstede's dimensions are as follows:

- Power Distance Index (PDI): This dimension measures the extent to which less powerful members of society accept and expect unequal distribution of power. Japan has a high PDI score of 54, which means that there is a significant power distance between managers and employees. In Japanese business culture, managers are expected to make decisions and provide guidance, while employees follow directions without questioning authority.

- Individualism (IDV): This dimension measures the level of interdependence among people in a society. Japan has a low IDV score of 46, which means that it is a collectivist society where the needs of the group are valued over the needs of the individual. In the business context, this means that Japanese companies prioritize long-term relationships and loyalty over short-term gains, and decisions are made based on the consensus of the group rather than individual interests.

- Masculinity (MAS): This dimension measures the level of achievement, assertiveness, and competitiveness in a society. Japan has a high MAS score of 95, which means that it is a highly competitive society where achievement and success are highly valued. In the business context, this means that Japanese companies are focused on achieving long-term success and growth, and employees are expected to work hard and be dedicated to their jobs.

- Uncertainty Avoidance Index (UAI): This dimension measures the level of tolerance for uncertainty and ambiguity in a society. Japan has a high UAI score of 92, which means that it has a low tolerance for uncertainty and ambiguity. In the business context, this means that Japanese companies prioritize stability and predictability, and decisions are made based on careful analysis and planning.

In summary, these dimensions impact the way business is done in Japan by emphasizing the importance of hierarchy, group harmony, achievement, and stability. Japanese companies prioritize long-term relationships and stability over short-term gains and are focused on achieving long-term success and growth. Japanese employees are expected to work hard, be dedicated to their jobs, and follow directions without questioning authority.

Help PLeasee
The US has a two-party system of government. Explain how this particular system supports the American form of government.

Answers

Answer:

Explanation:

For example, in the United States, the Bahamas, Jamaica, and Zimbabwe, the sense of two-party system describes an arrangement in which all or nearly all elected officials belong to either of the two major parties, and third parties rarely win any seats in the legislature.

Slave cultures
a. were entirely American and retained no African cultural elements.

b. were based on the same fundamental ideas and culture as their masters’ culture.

c. were entirely African and did not embrace any American elements.

d. are lost to history, as no evidence of them has survived.

e. were semi-independent and centered on family and church.

Answers

The answer would most likely be A or B

please help me with this history question i’ll give you brainlist and points

Answers

Answer: Choice B

Explanation: During the Chinese civil war, the communists and nationalist parties in China temporarily stopped fighting to work together in the fight against invading Japanese forces. This temporary truce was known as the Second United Front, and it lasted from 1937 to 1945. The Chinese saw the Japanese invasion as a greater threat to their country than the internal conflict between the two parties, so they put aside their differences to fight against the common enemy. After the defeat of Japan in 1945, the civil war resumed, and the communists eventually emerged as the victors in 1949.

six reason how the berlin conference reached to conclusion​

Answers

Answer:

Here are six reasons how the Berlin Conference reached its conclusions:

Division of Africa: The primary objective of the Berlin Conference was to divide Africa into territories that would be controlled by European powers. This was achieved through negotiations between the attending countries, where they agreed on the boundaries of the territories they would claim.

Recognition of territorial claims: The Conference recognized the territorial claims of European powers in Africa, as long as they had effective occupation and administration of the territory. This led to the formalization of colonial rule in Africa.

Free trade: The Conference agreed on the principles of free trade in the Congo Basin and the Niger and Congo rivers. This was intended to promote commerce and economic development in these regions.

Humanitarian concerns: The Conference recognized the need to address the humanitarian concerns of the African population, including the suppression of the slave trade and the promotion of human rights. However, these concerns were largely overshadowed by the interests of the European powers.

Colonial administration: The Conference established rules for the administration of colonial territories, including the provision of infrastructure, education, and healthcare. However, these rules were often not enforced and colonial administration was frequently exploitative.

International recognition: The conclusions reached at the Berlin Conference were recognized internationally, and other countries who wished to establish colonies in Africa were expected to abide by them. This led to the formalization of European colonial rule in Africa and the exploitation of its resources for the benefit of European powers.

Explanation:

Use the drop-down menus to complete the statements about counterclaims and rebuttals in an argumentative essay.
A counterclaim is a(n) .
A uses logical reasons to argue against a counterclaim.
When forming a rebuttal, the writer must include .

Answers

Declaring an essay's thesis is the first step in creating an effective argument. Evidence is used to support claims. Defining your stance and stating a claim is the first stage in developing an argument. Your position is obviously your point of view, and your reasons should in some way support that position.

How significant is the claim in an argumentative essay?

The fundamental contention of an essay is stated as a claim. It is perhaps the most crucial component of a research paper. The intricacy, usefulness, and caliber of the entire document are determined by the assertion.

The assertion will be your thesis statement. Make sure your writing is exact and clear. Your position on the matter must be clear to the reader. Your readers' ability to understand your points of view depends on how clearly you state your proposition.

A rebuttal can be made by the author by bringing forward counterarguments. An argument or piece of evidence that refutes an argument is known as a rebuttal. The author might then refute the counterclaim inside their own argument by bringing forth a counterclaim.

Learn more about claim:

https://brainly.com/question/14551819

#SPJ1

What economic challenges did President Nixon face?

- supply chain breakdowns

- a growing trade deficit

- declining U.S. industrial productivity

- rising inflation

Answers

- a growing trade deficit
- rising inflation

By far the biggest challenge Nixon faced as head of a growing federal government came from the nation's economic woes. Nixon entered office during a period of increased industrial competition from Japan and Western Europe and rising international prices for raw materials, especially oil. He also inherited a federal deficit that had escalated along with the war in Vietnam. Both factors contributed to a spike in inflation, which hurt the Republicans in the midterm elections that year. Americans also worried about the declining demand for their manufactured goods. For the first year since 1893, the United States imported more than it exported in 1971.

How did the discovery of oil change Texas society and technology

Answers

It changed Texas because it gained a lot of money from oil resources since oil sells for a lot

Who is to blame for crime and poverty in black neighborhoods according to Malcolm X?
the U.S. Senate
white Americans
blacks who failed to support other blacks
the Supreme Court

Answers

According to Malcolm X, white Americans are to blame for crime and poverty in black neighborhoods. Option B

Malcolm X believed that the root causes of crime and poverty in black neighborhoods were systemic racism and oppression perpetuated by white Americans.

He argued that the U.S. Senate, the Supreme Court, and other institutions upheld and enforced laws and policies that discriminated against black people and kept them in a cycle of poverty.

Malcolm X also placed blame on black individuals who failed to support each other, calling for unity and collective action in the fight against racism and poverty. He saw these issues as interconnected and argued that they could only be addressed through a radical restructuring of society that prioritized justice and equality for all people.

Overall, Malcolm X saw crime and poverty in black neighborhoods as symptoms of a larger problem of systemic racism and oppression, and called for a comprehensive approach to addressing these issues. So Option B is correct .

For more question on poverty visit:

https://brainly.com/question/28468793

#SPJ11

Which sentence in this excerpt from Susan B. Anthony’s “On Women’s Right to Vote” reveals the purpose of the speech? Friends and fellow citizens: I stand before you tonight under indictment for the alleged crime of having voted at the last presidential election, without having a lawful right to vote. It shall be my work this evening to prove to you that in thus voting, I not only committed no crime, but, instead, simply exercised my citizen's rights, guaranteed to me and all United States citizens by the National Constitution, beyond the power of any state to deny. The preamble of the Federal Constitution says: "We, the people of the United States, in order to form a more perfect union, establish justice, insure domestic tranquility, provide for the common defense, promote the general welfare, and secure the blessings of liberty to ourselves and our posterity, do ordain and establish this Constitution for the United States of America." It was we, the people; not we, the white male citizens; nor yet we, the male citizens; but we, the whole people, who formed the Union. And we formed it, not to give the blessings of liberty, but to secure them; not to the half of ourselves and the half of our posterity, but to the whole people - women as well as men. And it is a downright mockery to talk to women of their enjoyment of the blessings of liberty while they are denied the use of the only means of securing them provided by this democratic-republican government - the ballot.

Answers

Answer: It shall be my work this evening to prove to you that in thus voting, I not only committed no crime, but, instead, simply exercised my citizen's rights, guaranteed to me and all United States citizens by the National Constitution, beyond the power of any state to deny.

Explanation: She says it shall be my work this evening to prove to you...

Under a communist command economy, who makes decisions about production of goods and services?

Answers

Answer:

the consumer make decisions of product or service to be produced

What role did the us have in the 6 day war

Answers

Answer: sponsored a United Nations resolution establishing the United Nations Emergency Force presence between the Egyptians and the Israelis. During the run up to the Six-Day War, the Americans repeatedly rebuffed Israeli requests for military aid and approval for an Israeli preemptive attack on Egypt.

Explanation:

Do you consider "American Exceptionalism" a truth or a myth? Defend your answer.

Answers

Answer:

Explanation:

I consider American exceptionalism to be a myth, rather than a truth, for several reasons. First of all, American exceptionalism is based on a selective and biased interpretation of history, which ignores or downplays the negative aspects of the United States’ past and present, such as slavery, racism, genocide, imperialism, inequality, corruption, and violence. Second of all, American exceptionalism is based on a false assumption of moral superiority, which ignores or dismisses the contributions and values of other cultures and nations, and which justifies the interference and domination of the United States over other peoples and regions. Third of all, American exceptionalism is based on a dangerous illusion of invulnerability, which ignores or denies the challenges and threats that the United States faces in a complex and changing world, and which prevents the United States from learning from its mistakes and adapting to new realities.

Therefore, I think that American exceptionalism is a myth that needs to be challenged and rejected. It is not only inaccurate and arrogant, but also harmful and irresponsible. It prevents the United States from engaging in honest self-criticism and constructive dialogue with other nations. It alienates and antagonizes potential allies and partners. It undermines the credibility and legitimacy of the United States as a global leader and actor. It hinders the development of a more peaceful, just, and sustainable world order.

Instead of clinging to the myth of American exceptionalism, I think that the United States should embrace a more humble and realistic view of itself and its role in the world. It should acknowledge its flaws and failures, as well as its strengths and achievements. It should respect and appreciate the diversity and complexity of other cultures and nations. It should cooperate and collaborate with other actors on common interests and challenges. It should seek to be a responsible and constructive member of the international community, rather than an exceptional and dominant one.

Which of the following most accurately describes Europe at the end of World War II?

A damaged economy but with strong infrastructure
Widespread destruction with occupying armies throughout
Mostly stable with some minor disrupted supply lines
Many simultaneous civil wars with retreating Allied troops

Answers

B. Widespread destruction with occupying armies throughout most accurately describes Europe at the end of World War II.

Read the story of Zacchaeus and write about how the crowd of people misjudged Jesus’ ministry to Zacchaeus. Tell at least one lesson we can learn from the mistake of the people and explain how you can apply that lesson to the life and ministry of Christians today. Your essay should be at least 250 words

bible wasn't on list so i just put history.

Answers

A little, wealthy man named Zaccheus is the main character of a biblical story. According to Luke 19:1–10, Zaccheus was the chief tax collector and was despised by everyone for his wickedness.

Write on how the crowd misunderstood Jesus' treatment of Zacchaeus.

A large throng had gathered around Jesus when he first arrived in Jericho. As a rather short man, Zacchaeus scaled a sycamore tree to see the face of the Christ. When Jesus came upon him, he approached him and asked for a place to stay. When they saw it, a lot of people were appalled, especially those who knew Zaccheus. For some people, it may appear unjust or inappropriate. Zaccheus was a nasty, deceitful person. As a tax collector, he committed corruption against those who paid taxes. He was despised by many because of his deeds and use of his position to further his own interests.

As a result, when Jesus informed Zaccheus that He would be staying at his home, Zaccheus was perceived as being unable to serve as the Christ's host due to his sinfulness. Zaccheus used money for his own benefit. Despite the fact that Jericho was home to many law-abiding, honorable people, Jesus chose Zacchaeus. Zaccheus appears inappropriate or unqualified to others around him due to his immorality.

Yet Jesus came to this world to conquer sin, not to gain the favor of the virtuous. Jesus recognized a characteristic in Zaccheus that others had missed. He encouraged him to improve himself, act morally, and change his conduct rather than focusing on his past wrongdoings.

We are all subject to the societal norms that are required of us in today's judgemental world. Some people try to paint a negative picture of other people based on their past. The key moral of the tale is to avoid making quick decisions about individuals based only on their past. It is true that our past experiences have shaped who we are now, but it does not mean that who we are today is a result of what we are doing right now. During time, humans change, often for the better. Give someone a second chance, don't hold him accountable for his past mistakes, and focus on the future instead. Since He doesn't discriminate against anybody and appreciates each individual for who they can become rather than where they came from, He went to visit Zaccheus.

Like Zaccheus, we are all sinners. Let's follow Zaccheus' example of improvement and trust the Lord to deliver us.

Learn more about corruption: https://brainly.com/question/16224876

#SPJ1

why did martin luther regretted causing a split in the church

Answers

Answer:

because he didn't mean to create a separate church, but rather reform the existing Catholic Church from within.

As the movement grew, it led to a split in the church, with followers of Luther and other reformers breaking away to form new denominations. This caused a great deal of upheaval and conflict within the church, and Luther himself came to regret the division and strife that resulted. In particular, he was troubled by the violence and persecution that occurred as a result of the religious conflict, and he continued to hope for reconciliation between the various Christian factions

3. Which of the following events made it possible for the Allies to push forward against German forces? Select all that apply.
Battle of Britain
surrender of France
liberation of Paris
D-Day invasion
crossing at the Rhine

Answers

The Allied forces were able to push forward against the German forces because of several key events. These events include the surrender of France, the Battle of Britain, the liberation of Paris, the D-Day invasion, and the crossing at the Rhine. Each of these events played a significant role in weakening the German forces and providing the Allies with the strategic advantage they needed to continue their advance. The surrender of France allowed the Allies to gain control of important resources and infrastructure in the country, while the Battle of Britain prevented the Germans from gaining air superiority. The liberation of Paris and the D-Day invasion allowed the Allies to establish a foothold in Europe and begin pushing further inland, while the crossing at the Rhine ultimately led to the defeat of Germany and the end ofthe war in Europe.

The Battle of Britain and the liberation of Paris came next, which enabled the Allies to advance against the German forces. So, choices (A) and (C) are the right answers.

What do you know about German forces?

In 1871, while Germany was being united under Prussian rule, an army was formed that was armed, structured, and trained according to a single philosophy and was always under one command. The German land forces were officially referred to as the Deutsches Heer (German Army) from 1871 until 1919.

The main army was disbanded after Germany lost World War I and the German Empire collapsed. The German land troops were referred to as the Reichsheer (Army of the Empire) from 1921 and 1935 and as the Heer between 1935 and 1945. In contrast to the Heer, the Waffen-SS was not a division of the Third Reich's Heer, one of its two ground divisions during World War II.

Learn more about German forces, from :

brainly.com/question/9239138

#SPJ2

The one and only ivan

How do Stella and Ivan comfort each other?
A. They cuddle up at night.
B. Talk and share stories.
C. Draw pictures for each other.
OD. Make jokes about Mack.

Answers

To make each other comfortable Stella and Ivan used- A. to cuddle up at night.

According to the film "The one and only Ivan" which has characters named Ivan the Gorilla and Stella as the lead actress, Ivan and Stella's actions towards one another, such as snuggling, reveal their connection.

Hence, the correct answer is A. They cuddle up at night.

Cuddling?

Any forms of contact, including cuddling, can be intimate. According to St. John, cuddling is a wonderful method to show physical connection and affection in a relationship.

It "may help foster a sense of intimacy and security and can be a highly personal experience."

To know more about Relationships visit:

https://brainly.com/question/2500832

#SPJ1

The 1950s BE SURE TO FINSH YOUR DINNER. THERE ARE CHILDREN STARVING IN CHINA AND INDIA! Today BE SURE TO FINISH YOUR HOMEWORK. THERE ARE CHILDREN STUDYING IN CHINA AND INDIA.
If you're totally illiterate and living on one dollar a day, the benefits of globalization never come to you.
Write one to two paragraphs about the political cartoon and the quote shown above. Discuss the meaning of the cartoon and the quote, the changes in the US economy in recent years, and some of the reasons for the change. Express some of the positive and negative effects of out-sourcing / off- shoring and globalization.​

Answers

Answer:The political cartoon depicts a person living in poverty and excluded from the benefits of globalization. The quote highlights the reality that the benefits of globalization do not reach everyone, particularly the impoverished and illiterate. In recent years, the US economy has undergone significant changes due to globalization, resulting in increased efficiency and lower costs for businesses, but also job losses and increased inequality. Globalization can have positive effects, such as job creation and greater access to goods, but it can also lead to job losses, lower wages, and increased inequality, especially in developing countries where labor standards may be weaker. Policymakers need to ensure that the benefits of globalization are shared more equitably and that workers are protected.

Explanation:

Help ASAP Select all of the states that were part of the Confederate States.

*hint...there are 11

Maryland


Ohio


Alabama


Iowa


Massachusetts


Pennsylvania


Georgia


Missouri


Kentucky


West Virginia


Wisconsin


Indiana


Tennessee


Delaware


Arkansas


New Jersey


Florida


South Carolina


Connecticut


Minnesota


Vermont


Mississippi


Virginia


Louisiana


California


Texas


Maine


Kansas


Oregon


New York


North Carolina


Illinois


Rhode Island


New Hampshire


Michigan

Answers

The states that were part of the Confederate States were:

Alabama

Arkansas

Florida

Georgia

Louisiana

Mississippi

North Carolina

South Carolina

Tennessee

Texas

Virginia

Option B: REQUIRED RESPONSE ESSAY 2: 1200 words: A) In your own words, summarize the findings and implications of both studies of offender recidivism and how prisons arguably contribute to the problem (that is, contribute to high recidivism). Quote directly from at least 3 different assigned readings (and properly cite them). [THE TWO STUDIES YOU SHOULD USE ARE: "Recid of Prisoners 2005 in 30 States" and "Recidivism of Released Prisoners in 1994-1",

Answers

Identifying risk factors for recidivism among offenders has received significant scientific attention. These risks include traits including a history of criminal activity, an unstable lifestyle (such as being unemployed or frequently moving), and unfavorable peer relationships.

What are the factors associated with recidivism?

Criminal history, age at discharge, and neighbourhood characteristics were the three variables most frequently linked to the probability of recidivism across conditions.

It is common practice to file further charges against someone who has been arrested for a public order infraction. This is particularly true for parole or probation infractions, which are frequently brought on by committing another felony. Assault, theft, and drug possession are the other three offences that released inmates commit most frequently.

According to research, around two-thirds of those who have served time in prison will be imprisoned again within three years. Recidivism causes suffering for offenders, their family, and the victims of their crimes.

Learn more about recidivism:

https://brainly.com/question/28988114

#SPJ1

Other Questions
Approximately ____ percent of professionals working on virtual teams have never met their teammates in person, Mutiple Choice a 25 b 40 c 75 d 90 Lines AC and DB intersect at point W. Also, mDWC=138. PLEASE HELP TY What is the central idea of this poem?Women must be happy in order to enjoy protection.When protected, women experience total happiness.Religious customs, like the Pardah, lead tohappiness.No one, no matter how protected, can escape thesorrow in life. Compare Zora Neale Hurston's Sweat with Spunk For an experiment, Bea recorded how much each of 14 seedlings grew in one month. She made a line plot to show the data. Which value occurred most often? Anyone know how to solve this? Can anybody help me ASAP 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC when an investor compares their required return to the expected return on an investment, they are utilizing the explain in 100 words Compare the similarities between Capitalism and Socialism. Garcia Co. Sells snowboards. Each snowboard requires direct materials of $112, direct labor of $42, and variable overhead of $57. The company expects fixed overhead costs of $659,000 and fixed selling and administrative costs of $125,000 for the next year. It expects to produce and sell 11,200 snowboards in the next year. What will be the selling price per unit if Garcia uses a markup of 10% of total cost find the next three terms in the sequence 3/4, 1/2, 1/4, 0 Acme corp. is a leading provider of radios to the commercial market. its products all rely on printed circuit-board technology. acme has protected its market leadership with continued advancements in this technology, which it patents. a competitor has developed a radio for this market with equal performance but uses a software-based technology instead of circuit boardsis acme's technology leadership(compeptitive advantage) sustainable? why/ why not (what capability tests does acme's technology leadership fail?) calculate the molality of a solition with 85 g of KOH added to 590. g of water The amount of uniformity in the size of rock or sediment particles is called find the distance between each pair of points. (5 1/2, -7 1/2) and (5 1/2, -1 1/2) The figure shows a 25-cm-long metal rod pulled along two frictionless, conducting rails at a constant speed of 3. 5 m/s. The rails have negligible resistance, but the rod has a resistance of 0. 65 The Preamble includes the phrase "to form a more perfect union." Why is this reason listed for creating a new Constitution? A. because the people believed that the British had been unfair rulers B. because the United States would unite all of North America under one government C. because the government under the Articles of Confederation had not been effective D. because the new government was meant to be ruled by the people Christine has 5 coloured sweets in a bag. 1 of the sweets are red and 4 are green. She removes a sweet at random from the bag, notes the colour, and does not replace the sweet in the bag. She then chooses a second sweet at random. P(double green) P(Red | green) P( ) P(Green) Two days after he bought a speedometer for his bicycle; Lance brought it back (0 the Yellow Jersey Bike Shop. FThele problemn with this speedomeler;' Ba Lance complained to the clerk "Yesterday [ cycled the 22-mile Rogadzo Road Trail in 70 minutes and nOt once did the speedometer read above [5 miles per hour"" Yeah?" responded the clerk " What' $ the problem?" To explain Lance's complaint, first compute his average velocity: (Use decimal notation. Give your answer tO two decimal places ) average velocity: DNE mileshcur Incorrecr