The best fruit punch requires 2/5 cup of juice concrete to 3/7 cups of water. To maintain the same taste, how many cups of water should be used for every cup of juice concentrate?
a. 6/35
b. 14/15
c. 29/35
d. 15/14

Answers

Answer 1

Answer:

D) 15/14

Step-by-step explanation:

Divide 3/7 by 2/5

Answer 2
Answer is D) I hope this helped :)

Related Questions

A scoop of ice cream in the shape of a whole sphere sits in a right cone. the radius of the ice cream scoop is 2.5 cm and the radius of the cone is 2.5 cm. How tall must the height of the cone be to fit all the ice cream without spilling if it melts? SHOW ALL YOUR WORK!!!

Answers

Answer:

(At least) 10 centimeters.

Step-by-step explanation:

The radius of the ice cream scoop is 2.5 cm and the radius of the cone is also 2.5 cm.

We want to determine the height of the cone such that it will fit all of the ice cream when it melts without any spilling.

First, we will find the volume of the ice cream scoop. The volume for a sphere is given by:

[tex]\displaystyle V=\frac{4}{3}\pi r^3[/tex]

Since the radius is 2.5 cm, the volume of the full ice cream scoop is:

[tex]\displaystyle V=\frac{4}{3}\pi (2.5)^3[/tex]

Use a calculator:

[tex]V\approx 65.4498\text{ cm}^3[/tex]

The volume of a cone is given by:

[tex]\displaystyle V=\frac{1}{3}\pi r^2h[/tex]

The radius of the cone is 2.5 cm. Therefore:

[tex]\displaystyle V=\frac{1}{3}\pi(2.5)^2h=\frac{1}{3}\pi(6.25 h)=\frac{6.25\pi}{3}h[/tex]

The volume of the cone should be equal to the volume of the scoop. So:

[tex]\displaystyle 65.4498=\frac{6.25\pi}{3}h[/tex]

Solve for h:

[tex]\displaystyle h\approx 65.4498\Big(\frac{3}{6.25\pi}\Big)=10\text{ cm}[/tex]

The height of the cone should be (at least) 10 cm.

Somebody please help me!
This is my question.

Evaluate 12.3p + 11.7r when p = 6 and r = 7.

And then it’s written like this.

12.3(_)+11.7(_)=_+81.9
=_

Answers

Method:

First place the replace of p and r using brackets.

= 3(6) + 11.7(7)

3 times 6 is 18 and 11.7 times 7 is 81.9

= 18 + 81.9

add one and one together you get

= 99.9

hope it helps

Five times a number is 49 greater than the product of 2 and the opposite of the number, What is the number?

Answers

Answer:

The answer is 7

Step-by-step explanation:

5x+2x=49-2x+2x

7x=49+0

7x/7=49/7

x=7

The number is 7 if five times a number is 49 greater than the product of 2 and the opposite of the number.

What is a linear equation?

It is defined as the relation between two variables, if we plot the graph of the linear equation we will get a straight line.

If in the linear equation, one variable is present, then the equation is known as the linear equation in one variable.

It is given that:

Five times a number is 49 greater than the product of 2 and the opposite of the number.

Let the number is x:

From the statement "Five times a number is 49 greater than the product of 2 and the opposite of the number" we can frame a linear equation in one variable:

5x + 2x = 49 - 2x + 2x

After solving the above equation:

7x = 49

x = 49/7

x = 7

Thus, the number is 7 if five times a number is 49 greater than the product of 2 and the opposite of the number.

Learn more about the linear equation here:

brainly.com/question/11897796

#SPJ2

The formula for the volume of a cone is V = 1/3 πr^2 h. Which part of the formula represents the area of the base?

Answers

πr^2 - the base of a cone is a circle, so use the equation for area of a circle

18-10=5+5
Solve & answer T for True or F for False

Answers

Answer:

False

Step-by-step explanation:

I don't know much about math but

if u say 5+5= 10

5+10=15

nothing make 18 so

it false

Here is a picture of a cube and the net of this cube what is the surface area of this cube enter your answer in the box

Answers

Answer:

Step-by-step explanation:

a = 12 mm

Surface area of cube = 6a²

                                   = 6 * 12 * 12

                                   = 864 cubic mm

★Answer[tex] \sf \pink{As \: We \: Know,} \\ \\ \tt \: \color{pink}\leadsto \: Surface \: Area \: Of \: Cube \: = {6a}^{2} \\ \\ \tt \green{ \: Here; \: a = 12mm }\\ \\ \tt \: \color{green}Surface \: Area \: = {6 \times 12 \times 12}^{} \\ \\ \pink{\leadsto \: = 864 {mm}^{3} }[/tex]Hence , The Answer is 864mm³.

find the area asap i really need help 30 minutes left plzz

Answers

Answer:

45mm

Step-by-step explanation:

First, find the whole area of the square, which is 225 mm squared.

Then, we have to find the area of the shaded trapezoid. Remember, the area of the trapezoid is [tex]\frac{h(b^{1}+b^{2} }{2}[/tex]

We get the area of the trapezoid to be 180 mm.

We subtract 180 from 225 mm to get 45 mm as our answer.

Help me plz right answer

Answers

what’s up again douglas. it would be B

Answer:

the answer is b

Step-by-step explanation:

you have to divide 6.50 by 5 to see how much 1 bar will cot

6.50 divided by 5 is 1.3

Find the missing length of the triangle.

Answers

Answer:

B=5.44 i think hopefully

10
A cone has a volume of 98 cm.
The radius of the cone is 5.13 cm.
Work out an estimate for the height of the cone.

Answers

Answer:

3.56 cm.

Step-by-step explanation:

1/3 π r^2 h = V

1/3 π (5.13)^2 h  = 98

h = 98 / (1/3 π (5.13)^2)

=  98 / 27.55899

= 3.556.

Cone is a shape of a Christmas tree where there is a base of radius r and a top point called the apex.

If the volume and radius of a cone are 98 cm and 5.13 cm.

The height of the cone is 3.56 cm.

What is a cone?

It is a shape of a Christmas tree where there is a base of radius r and a top point called the apex.

The volume of a cone is 1/3πr²h.

Example:

The cone has a radius of 2 cm and a height of 3cm.

The volume of a cone:

= 1/3 x 3.14 x 4 x 3

= 12.56 cm³

We have,

Cone:

Volume = 98 cm

Radius = 5.13 cm

Height of the cone = h

The volume of a cone:

V = 1/3πr²h

98 = 1/3 x π x (5.13)² x h

[ Take π = 3.14 ]

98 = 1/3 x 3.14 x 26.31 x h

Multiply 3 on both sides.

98 x 3 = 3.14 x 26.31 x h

Divide both sides by (3.14 x 26.31).

h = (98 x 3) / (3.14 x 26.31)

h = 294 / 82.61

h = 3.56 cm

Thus,

If the volume and radius of a cone are 98 cm and 5.13 cm.

The height of the cone is 3.56 cm.

Learn more about cones here:

https://brainly.com/question/13798146

#SPJ2

find the errors and correct the following mathematical sentences:​

Answers

Answer:

You are supposed to correct the equation here not solve it.

How many joules of gravitational potential energy are stored in a system where a feather with a mass of 0.008 kilograms is positioned 22 meters above the ground?

Answers

Answer:

Step-by-step explanation: potential energy Ep = mgh

And g = 9.81 m/s². Ep = 0.0008 kg·9.81 m/s²· 22 m , unit is J

2/3 + 3/4 + 4/2. If a fraction appears in your answer, it should be in simplified form.

Answers

We must first make each fraction have a common denominator, this will be 12
2/3 * 4/4 = 8/12
3/4 * 3/3 = 9/12
4/2 * 6/6 = 24/12
we can then add the numerators of each fraction
8 + 9 + 24 = 41
so our answer is 41/12
we can not simplify any further and thus get
41/12

Help me please I give brainliest and be serious

Answers

13. Graph B because it is going through the most points and that is what a line of best fit should do.
14. Graph A because it is going through the most points.

Can you help A B C Or D image is here

Answers

Answer:

A

Step-by-step explanation:

B should be the correct answer

What is the equation of the line that passes through the point (7, 1) and is parallel to the line with the equation y=4x−1?

Answers

Answer:

Step-by-step explanation:

y=4x-1

y-1=4(x-7)

y-1=4x-28

y=4x-27

The Royal Fruit Company produces two types of fruit drinks. The first type is 35% pure fruit juice, and the second type is 100% pure fruit juice. The company is attempting to produce a fruit drink that contains 45% pure fruit juice. How many pints of each of the two existing types of drink must be used to make 260 pints of a mixture that is 45% pure fruit juice?

Answers

Answer:

first type of fruit juice (35%) = 4

second type of fruit juice (100%) = 4

Step-by-step explanation:

4×35 = 140

4×100 = 400

400-140 = 260

A grocer has 2 types of tea, one for sells for $8.00 per pound and the other for $6.00. How many pounds of each kind must he use to make 50 pounds of tea that will sell for $7.40 per pound

Answers

Equation::
value + value = value
80x + 60(50-x) = 74*50
----
80x + 60*50 - 60x = 74*50
----
20x = 14*50
x = 35 lbs (amt. of 80 cent tea to use)
50-x = 15 lbs (amt. of 60 cent tean to use)

Extreme Temperatures. The hottest temperature ever recorded in the United States was 134?F, which occurred at Greenland Ranch, California, in Death Valley on July 10, 1913. The coldest temperature ever recorded in the United States was -80?F, which occurred at Prospect Creek Camp, Alaska, in the Endicott Mountains on January 23, 1971. Determine the difference between these two temperatures.

Answers

Answer:

214

Step-by-step explanation:

a piece of work can be completed in 30 days by 10 men. if the work is to be completed 5 days earlier, how many more men are needed? (assume that the men work at the same rate)

Answers

Answer:

so, if 10 men can do it In 30 days, that means a total of 300 "man days".

300 man days divided by 25 days would be 12- so 2 more men.

Please help asap pretty easy question just stuck

Answers

Answer:

Circle Pentagon Triangle Rectangle

Please help! It’s urgent!

Answers

Answer:

ΔFGH≅ΔYZX

Step-by-step explanation:

For every 10,000 gallons of pool water, there needs to be 1 gallon of liquid chlorine. Steve has a 55,000 gallon pool. How much liquid chlorine does he need to add to his pool?​

Answers

Answer:

5.5 Gallons

Step-by-step explanation:

I need help, image should be attached

Answers

3 hours and 10 minutes hope this helps :D

What are the next three terms in the sequence 2.0, 3.5, 5.0, 6.5, ... ?

Answers

u add 1.5 everytime
so the next 3 terms: 8, 9.5 and 11

Find the identical expression for the following plz show work

Answers

THAT IS A VIRUS DO NOT GO TO IT DONT GO TO ANY LINK THEY ALL ARD VIRUSES


Select the lesser of the two given numbers.
16, 1-19

Answers

I’m confused, can you please explain more so I can help please

y - X=-5
y = 2x2-3x-5
PLEASE HELP AND SHOW WORK
(substitution)

Answers

Answer:

Step-by-step explanation:

y - x = -5

y =  x-5

y = 2x² - 3x - 5

x-5 = 2x² - 3x - 5

2x² - 4x = 0

x² - 2x  = 0

x(x - 2) = 0

x = 2, 0

(x,y) = (2,-3), (0,-5)

What is the circumference of the circle with a radius of 31

Answers

Answer:

circumference = 194.68

Step-by-step explanation:

c = π2r

c = (3.14)(2)(31) = 194.68

A mother bottlenose ate about 220 pounds of food in one week. About how much food did she eat in a day?

She ate about
pounds of food in a day.

Answers

Answer: 31.42
if you get it wrong im so sorry
Other Questions
What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie? Which student has the greater median test score? I have to study for a test. It's for data management. Does anyone have tips? (Grade 7) PLEASE HELP ME WITH ALGEBRA! THANK YOU Explain how Japan took control of Manchuria.