SOMEONE PLEASE HELP ME I WILL MARK BRAINLEIST

SOMEONE PLEASE HELP ME I WILL MARK BRAINLEIST

Answers

Answer 1

Answer:

i think the answer should be option •C

Answer 2

Answer:

C it provided trade access

Explanation:

HMU


Related Questions

You've been asked to contribute to an exhibit in a Holocaust museum. Consider the various groups who were persecuted. Choose one group that was persecuted and create a presentation that informs museum visitors about the experiences of this group. Your presentation should answer the following questions: Why was this group persecuted? What did this group experience during the Holocaust? How did the United States respond? What were the effects of the Holocaust on this group?

Answers

The group I chose were the jews this was a persecuted group because of hitlers childhood hatred for them. This group experienced different types of tortures like not having food living a in non humane conditions and many more things. The united states responded by partnering up with great Britain to take down the nazis. The effects were really big they went from separating families, taking they're belongings, killing them , etc

Americans took steps to alleviate the suffering of German Jews this group persecuted. It was the group of the experience in the during the Holocaust.  The United States respond was the non-humane conditions and the more thing.

What is Holocaust museum?

Holocaust museum was the oldest museum. The location of the Holocaust museum in the United States. It was the dedicated to remembering the 6 million Jews. Landscape of Loss, Memory, and Survival it was the remarkable in the conditions. he memory is the history and the landscape.

According to the Holocaust museum, was the Jews this was a persecuted group. It was the tortures like not having food living and the non-human and the conditions and many more things. It was the Great Britain and the separating families and the killing them, was the reality fact.

As a result, the significance of the Holocaust museum are the aforementioned.

Learn more about on Holocaust museum, here:

https://brainly.com/question/29707408

#SPJ2

World war 2

Under fascist ideology, Benito Mussolini and Adolf Hitler sought to

A.
promote nationalism and empower the people to take control of the means of production.

B.
promote nationalism and consolidate power by creating totalitarian governments.

C.
promote communism and empower the people to take control of the means of production.

D.
promote communism and consolidate power by creating totalitarian governments.

Answers

Answer:

B) promote nationalism and consolidate power by creating totalitarian governments.

Explanation:

I'm a world war two nerd

In what way did Europe's aging population create a need for immigrants? (TWO EXAMPLES)​

Answers

Answer: Aging may reduce migration as older people tend to migrate less than young. Aging may lead to lower migration of workers of all ages as a result of lower labor demand for migrants.

Aging is also present in migrant-sending countries, where both facts exacerbate the negative effects

Explanation:

Describe the three stages of Jesus' Galilean ministry.


First stage:


Second stage:


Third stage:


First stage: Second stage: Third stage:

Answers

Answer:

First stage: Baptism

Second stage: Formation of the primitive church.

Third stage: Last week in Jerusalem.

Explanation:

Some scholars and religious organize the ministry of Jesus in three stages, allowing a greater understanding of his evangelistic life and how the facts about his existence should be managed. The first stage is the baptism of Jesus, where he is first presented as a son of God and begins his journey of preaching, pilgrimages and miracles. The second stage refers to the formation of the primitive church, where Jesus gathers the disciples and begins to get followers who hear his words about God. The third stage refers to Jesus' last days before his death and begins with the moment when he enters Jerusalem, ending with his last week in Jerusalem.

Answer:

First stage: included Jesus' public ministry where he preached and accomplished many miracles in the multitudes.

Second stage: included private ministry and teaching in parables.

Third stage: many people denied Jesus as the Messiah. Jesus continued his private ministry and trained the twelve disciples to be his apostles

Explanation:

What are the ways in which new immigrants are changing Europe?​

Answers

Answer: Migration increased the slum areas in cities which increase many problems such as unhygienic conditions, crime, pollution etc.

Explanation:

What argument is Truman making in this document?
The United States should join the United Nations.
Congress should not approve the Marshall Plan.
The United States should work to contain communism.
People do not have the right to choose their form of government.

Answers

Answer:

C. The United States should work to contain communism.

Explanation:

I got it right on Egde 2021 pls mark me brainlest!!!

Which was a result of the Vietnam War?

Answers

Answer:

North Vietnam won the war

Explanation:

North Vietnam won the war. Vietnam was united as one country under Communist rule.

good morning guys I hope you have great day toady can you please help me i will mark u as my b

Answers

Answer:

A

Explanation:

Sorry if this is wrong, but i believe that's the best answer because she would have to have data to show that the scientist is wrong.

Hi Riner :)

Why (do you think) Japan refused to surrender?

Answers

Answer:

I don't know what you mean about Japan refusing to surrender but maybe this could be helpful. don't copy word for word. I have two answers for u. hope I helped.

1. After the Hiroshima attack, a faction of Japan's supreme war council favored acceptance of the Potsdam Declaration, but the majority resisted unconditional surrender. On August 8, Japan's desperate situation took another turn for the worse when the USSR declared war against Japan.

2. Washington has believed ever since that the atomic bomb decisively forced Japan's surrender. ... With defeat imminent, Japan's leaders feared that without the imperial house, the state and their own power would be devalued and diminished in the eyes of the people, and that the state would ultimately disintegrate.

Will give brainliest and it’s 20 points please hurry

Answers

A cabinet level agency, the Department of Housing and Urban Development (HUD) oversees federal programs designed to help Americans meet their housing needs. ... Congress created the Federal Housing Administration (FHA) in 1934 to help Americans with their housing needs during the Great Depression.

I hope this is what you are looking for.

Magnets have to poles east and west: true or false

Answers

Answer:

False. Magnets only have a north and south pole.

Answer: false they only have N and S

Explanation:

Q. What were the north's economic strengths

Answers

Answer:

The North had a greater industrial advantage.

Explanation:

n 1860, the North manufactured 97% of the country firearms, 96% of its railroads, 94% of it cloth, 93% of its pig iron and over 90% of its boots and shoes.

PLZ HELP ASAP ! I WILL MARK YOU BRAINLIEST (( PLZ ONLY ANSWER IF YOU KNOW THE CORRECT ANSWER ))
Why did produce prices change so drastically after the War of 1812?
A.) The farmers in England and France were not able to grow their own food for their countries. The result was a rapid increase in farm produce prices in the United States to be exported.
B.) The farmers in the United States were not allowed to grow as many crops. The result was a rapid increase in farm produce prices in the United States to be exported.
C.) The farmers in the United States were not allowed to grow as many crops. The result was a rapid drop in farm produce prices in the United States.
D.) The farmers in Spain and Italy were not able to grow their own food for their countries. The result was a rapid increase in farm produce prices in the United States to be exported.
E.) The farmers in England and France were now able to grow their own food for their countries. The result was a rapid drop in farm produce prices in the United States.

Answers

Answer:c

Explanation:I did the research in my mind so I might be ronge

Stacey Abrams accomplishment

Answers

Answer:

Becoming the first African-American female major-party gubernatorial nominee in the United States.

Explanation:

In 2021, Abrams was nominated for a Nobel Peace Prize for her efforts in the 2020 election. Abrams was the Democratic nominee in the 2018 Georgia gubernatorial election, becoming the first African-American female major-party gubernatorial nominee in the United States.

For the second blank the options are “direct democracy” and “representative democracy”

Answers

Answer: 1) Anthenian democracy

2) direct democracy

Explanation:

Did mutually assured destruction contributed to US fear of communism?

Answers

get the app socratic the answer to your question is on there

Imagine living during the Stone Age. Cite 10 strategies/ways and means in surviving the Stone Age.​​

Answers

Sharpened sticks were used to hunt in the early Stone Age. Later, they used flint or bone-tipped spears and bows and arrows. Nuts and fruits were collected, and roots were dug up. They went fishing with harpoons and nets.

Stone Age people used sharpened stones to break up their food and cooked it over an open fire. Animal skins were used to make garments and shelters. People may feast after a successful day of hunting.

Which of the following was least important to the ruing class of Rome?
O A religion
OB
tradition
oc public service
od family order
Moving to another question will save this response

Answers

I think the answer is C

This green line, which represents a path that was blazed in 1804-1806, show what?

the Oregon Trail.

the Adams-Onís Trail.

the journey of Lewis and Clark.

Answers

The correct answer would be the last one. The journey of lewis and clark
the journey of lewis and clark

Levels of analysis on war

Answers

Answer:

In his 1959 book Man, the State, and War he explains the causes of war by distinguishing three levels (or “images”): the individual, the state, and the international system. On each level can be found causes that lead to international conflict.

Which senior officer last Fort Union before the Civil War to return to a Confederate state

Answers

Answer:

Ulysses S. Grant

Ulysses S. Grant was the final commander of the Union Army. He was famous for his victories in the West when he was appointed lieutenant general and general-in-chief of the Union Army in March 1864.

Explanation:

Major Sibley senior officer at last Fort Union before the Civil War returned to a Confederate state.

What do you mean by Confederate state?

After President Abraham Lincoln was elected, 11 states that made up the Confederate States of America seceded from the Union.

The Confederacy, headed by Jefferson Davis and lasting from 1861 to 1865, struggled for validity and was never acknowledged as a sovereign country.

During the American Civil War of 1861-1865, the Confederate States Army's (CSA) general officers were the Confederacy's top military officials.

Therefore, Major Sibley senior officer at last Fort Union before the Civil War returned to a Confederate state.

To know more about the Confederate state, visit:

https://brainly.com/question/29823950

#SPJ7

pitted the ideals of Nazi Germany and the U.S. against each other.
Select the best answer from the choices provided.
A.
The Harlem Renaissance
B.
The Louis-Schmeling match
C.
The Negro Leagues
D.
The UNIA

Answers

Answer:

B. The Louis-Schmeling match

Explanation:

The Louis-Schmeling match was a match between Louis of USA and Schmelding of Germany in the heavyweight title bout.

This was more than just a fight contest, it was a battle of supremacy between two countries to see who was stronger.

explain what the experience was like for nurses during ww1

Answers

Answer:

Many women went into factories, and were very good at setting fuses in shells and bullets. It was dangerous work, and the chemicals they dealt with made many ill. And, on the battlefield, the nurses stepped in. What they would experience over nearly five years of war was horror, privation, exhaustion and danger.

They had to go into factories and were very good at setting fuses in shells and bullets BUT it was a dangerous work

Please help!!
Do communists believe in private property

Answers

Answer:

Yes they support ownership of private properties

Explanation:

No they do not support ownership of private property. The economic beliefs are "seizing the means of production" for the "oppressed" working class. This transfers all property to the hands of the state.

Choose all of the items that represent an event during the administration of president jimmy carter.

Answers

Answer: B,C,E

Explanation:

The items that represents the events during the administration of president Jimmy Carter are statement B, C, E.

Who is Jimmy Carter?

From 1977 to 1981, Jimmy Carter presided as the 39th president of the United States. He received the 2002 Nobel Prize for Peace in recognition of his efforts to end international disputes via dialogue, strengthen human rights and democracy, and foster societal and economic growth.

The Carter Center was established by President Carter in Atlanta in 1982. He designs and manages initiatives to fight disease, enhance economic development and human rights, end violence, and advance democratic ideals globally through his nonprofit, nonpartisan Center.

The events during administration of Jimmy Carter

Camp David accordsIran hostage crisesCrises of confidence speech.

To learn more about Jimmy Carter

https://brainly.com/question/23064245

#SPJ2

how did the process of southernization change the culture of Southern Asia

Answers

Answer:

Southernization was well under way in Southern Asia by the 5th century, during the reign of India's Gupta kings  And one might even go so far as to suggest that in Europe and its colonies, the process of southernization laid the foundation for westernization.

How does reading a trial transcript provide a unique view into crime ?

Answers

It does because your reading it then it tells you about it.
It would be unique because it gives one a different perspective on not only the trail, but the involved parties to include the defendant & plaintiffs.

why did romans create a write code of law

Answers

Answer:

Roman law, the law of ancient Rome from the time of the founding of the city in 753 BCE until the fall of the Western Empire in the 5th century CE. It remained in use in the Eastern, or Byzantine, Empire until 1453. As a legal system, Roman law has affected the development of law in most of Western civilization as well as in parts of the East. It forms the basis for the law codes of most countries of continental Europe (see civil law) and derivative systems elsewhere.

Explanation:

The term Roman law today often refers to more than the laws of Roman society. The legal institutions evolved by the Romans had influence on the laws of other peoples in times long after the disappearance of the Roman Empire and in countries that were never subject to Roman rule. To take the most striking example, in a large part of Germany, until the adoption of a common code for the whole empire in 1900, the Roman law was in force as “subsidiary law”; that is, it was applied unless excluded by contrary local provisions. This law, however, which was in force in parts of Europe long after the fall of the Roman Empire, was not the Roman law in its original form. Although its basis was indeed the Corpus Juris Civilis—the codifying legislation of the emperor Justinian I—this legislation had been interpreted, developed, and adapted to later conditions by generations of jurists from the 11th century onward and had received additions from non-Roman sources.

What was the result of the election of 1828?

Answers

Answer:

Nominee  Andrew Jackson  John Quincy Adams

Party          Democratic                 National Republican

Home state   Tennessee                  Massachusetts

Running mate   John C. Calhoun         Richard Rush

Electoral vote           178                        83

Explanation:

Question 10 of 10
How did World War II affect the economy?
A. It increased the variety of consumer goods.
B. It decreased employment.
C. It increased wages.
D. It decreased the number of working women.
SULIT

Answers

World war lol effected the economy because it gave women the rights to work when it wasn’t usual to see them working because at the time every women was a stay at home wife. So after war it was normal to see women work it gave them the encouragement to do what only men were able to do.
Other Questions
DQuestion 2If a right triangle has side lengths 6, 6.7 and 3, which side is the hypotenuse?O 3O 6.7O 15.706 What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings?