oiii any tamil people put me a hai​

Answers

Answer 1

huh I dont understand your question.


Related Questions

what is the formula of presure

Answers

Answer:

P=F/A

Explanation:

P. Is pressure

F is force

A is area

Is it possible to analyze the motion of an object that has non-constant acceleration?

Answers

Answer:

B

It is possible, but with formulas not yet derived by physicists.

Explanation:

Yes, it is possible to analyze the motion of an object that has non-constant acceleration but not with the help of Newton's equation of motion, as these equations are only valid for constant acceleration.

What are the three equations of motion?

There are three equations of motion given by  Newton,

v = u + at

S = ut + 1/2×a×t²

v² - u² = 2×a×s

Note that these equations are only valid for a uniform acceleration.

It is feasible to study an object's motion with non-constant acceleration, but not using Newton's equations of motion because these equations are only applicable for constant acceleration.

For analyzing the variable acceleration we have to use the calculus tools such as differentiation and integration.

Hence, it is possible to analyze the motion of an object that has non-constant acceleration

Learn more about equations of motion from here,

brainly.com/question/5955789

#SPJ6

Calculate the work done by a 60 N force pushing a pencil 0.25 m

Answers

In case we are asked useful work done then we calculate net force used for pushing the pencil:
Net force used for pushing the pencil
=
47

23
=
24

N

Assuming that direction of movement of pencil and net force is same.
Useful Work done by force in moving the penc

(Forensic Science)

Officer Piddington has been called to a murder scene. He arrives to find EMTs tending to the victim lying on the living room floor with a large knife protruding from his sternum. It is clear that this is where the crime occurred, and Officer Piddington does not see any evidence of dangerous chemicals on site. He secures the area and then begins to document the scene. What is one of the first things that Officer Piddington records in his notes about the crime scene?

The victim's past criminal history
A description of the crime scene when he arrived
The estimated time of death of the victim
A list of possible suspects involved in the crime

Answers

Answer:

The answer is B

Explanation:

The detective begins his/her documentation of the crime scene by writing down the date, time, and location of the crime scene. this is always important to start the report with so that any who reads the notes know when and wher this all happened before reading about evidence other wise the reader could be confused and pass evidence off as faulty.

Answer:

A description of the crime scene when he arrived

Explanation:

Friction force is the opposition to the motion of surfaces sliding across each other. Based on your observations, what is one factor that affects the amount of friction?

Answers

One factor that affects the amount of friction is roughness or smoothness of the sliding object.

Factors affecting friction

There are several factors affecting the amount of friction and they include the following;

Roughness or smoothness of the sliding object.Roughness or smoothness of the surface.Shape of the object.Normal force acting upon the sliding bodies.Dry friction is independent of the surface area of a contact.

Thus, one factor that affects the amount of friction is roughness or smoothness of the sliding object.

Learn more about friction here: https://brainly.com/question/24338873

#SPJ1

Answer: It depends on the surface is the surface bumpy? Or is the surface flat and smooth?

Explanation: If a surface is to bumpy friction slows it down, if a surface is flat and smooth it glides with ease.

when your bikes in motion and you slam on the brakes, do you experience positive or negative acceleration?

Answers

Answer:

negative

Explanation:

Object’s motion + unbalanced force =
_____ velocity.

Answers

Answer:

constant velocity

A mountaineer jumps off a ledge (with a height of 5m) to cross a crevasse with a
gap of 2m. What was the mountaineer's horizontal velocity to clear the gap? (use g=10m/s/s) (answers are in m/s) *
1
2
4
8

Answers

Answer: the correct answer is 8 please let me know if I’m wrong

Explanation:

Johnny kicked a football from a hill 20 meters tall. The ball leaves at a 45.0 degree angle with an initial velocity of 30.0 m/second. How many seconds was the ball in the air? Report your answer to 3 sig figs. Seconds

Answers

Answer:

The value is [tex]t = 5.124 \ s[/tex]

Explanation:

From the question we are told that

   The height of the tree is [tex]s = 20 \ m[/tex]

    The angle the ball leaves is  [tex]\theta = 45^o[/tex]

    The initial velocity  is  [tex]u = 30.0 \ m/s[/tex]

Generally the vertical of the ball's initial velocity is mathematically evaluated as

      [tex]u_y = u * sin (45)[/tex]

=>   [tex]u_y =- 30 * sin (45)[/tex]

=>   [tex]u_y = -21.21 \ m/s[/tex]

Here  [tex]u_y[/tex] is negative because it is in the direction of the negative y-axis

Generally from kinematic equation we have

      [tex]s = u_yt + \frac{1}{2} g t^2[/tex]

=>   [tex]20= -21.21 t +4.9 t^2[/tex]

=>   [tex]4.9 t^2 -21.21 t- 20= 0[/tex]

Solving using quadratic formula we have that

        [tex]t = 5.124 \ s[/tex]

   

A 60-kg person walks from the ground to the roof of a 74.8 m tall building. How much gravitational potential energy does she have at the top of the building?

Answers

Given :

Mass of person, m = 60 kg.

Height of roof of building, h = 74.8 m .

To Find :

How much gravitational potential energy does she have at the top of the building.

Solution :

We know, gravitational potential energy is given by :

[tex]P.E = mgh[/tex]

Here, g = acceleration due to gravity = 9.8 m/s².

P.E = 60×9.8×74.8 J

P.E = 43982.4 J

P.E = 44 kJ

Hence, this is the required solution.

If a squirrel climbs a tree at 16m/s, how many meters will it travel every hour?

Answers

Answer:

57600 m and hour

Explanation:

What is a coastal plain? A high mound or ridge of sand The boundary between the land and an ocean A flat, low-lying piece of land next to the ocean The piece of land formed when a river splits into smaller rivers

Answers

Answer:

Hi I learned that it is something pretty and it's a flat low-lying piece of land next to the ocean

Explanation:

Answer:

A coastal plain is flat, low-lying land adjacent to a sea cost. A fall line commonly marks the border between a coastal plain and a piedmont area. Some of the largest coastal plains are in Alaska and the southeastern United States.

Explanation:

7. A car drives 750 m directly to the north, stops, and then backs up 300 m to the south.
a) What is the magnitude of the car's displacement?

Answers

Answer:

what grade is this?

Explanation:

Answer:

is it cumpulsary to know how fast the car was moving or it dosn't have to deal with velocity

Explanation:

:)

EASY QUESTIONS! DUE IN 15 MIN WILL MARK BRAINLIEST.

1. What is the sum of a vector 8 m south and a vector 12 m north? *
2. What is the sum of a vector 12 m north and a vector 8 m north? *

PLEASE SHOW WORK AND EXPLAIN

Answers

Explanation:

As they are in same direction, you can add them directly. And result is 12 + 8 m = 20 m North. If you use vector addition: Vectors = 12m & 8 m & angle b/w them is 0°(as both are in same direction).

A plastic bottle lies sideways on the floor of a stationary bus. The bus driver starts the bus and moves forward. At a stop light, the bus comes to a sudden stop. According to Newton's laws of motion, which scenario correctly describes how the bottle will move?

Answers

Answer:

Explanation:

Initially, the plastic bottle lies sideways on the floor of a stationary bus, so the bottle is also in the stationary state.

When the bus starts moving, the bottle will try to maintain its state of rest as described by Newton's first law, due to which the bottle will slide in the backward direction and at the same time there is frictional force acting on the bottle in the forward direction by the bus floor due to which the speed of bottle starts increasing in the direction of the bus as described by Newton's second law.

After some time, the bus, as well as the bottle will move at the same constant speed as there is an application of frictional force.

On the sudden application of the break, the bus will reach the stationary position, but in order to maintain the inertia, the bottle will slide forward on the bus floor due to the inertia of the bottle as described by Newton's first law and at the same time there is frictional force acting on the bottle in the backward direction by the bus floor due to which the speed of bottle starts decreasing as described by Newton's second law.

A student athlete is participating in the hammer throw. The student rotates in uniform circular motion with the mass rotating 2.3 m away from the center of rotation.

Refer to the information and diagram shown above. The student athlete can rotate so that the object is moving with a speed of 10 m/s.

What is the acceleration necessary to keep the object in uniform circular motion?

Answers

The acceleration necessary to keep the object in uniform circular motion is 43.48 m/s²

From the question given above, the following data were obtained:

Radius (r) = 2.3 mVelocity (v) = 10 m/sAcceleration (a) =?

The acceleration required to keep the object in circula motion can be obtained as follow:

a = v² / r

a = 10² / 2.3

a = 100 / 2.3

a = 43.48 m/s²

Thus, the acceleration required to keep the object in circula motion is 43.48 m/s².

Learn more about centripetal acceleration: https://brainly.com/question/1112940

A satellite is orbiting Earth with a speed of 8,000 m/s. How far is the satellite from Earth’s center?

Answers

Answer:

8 million miles

Explanation:

believe me


A wagon, initially traveling at a constant 8.5 m/s, starts going down a hill that creates an
acceleration of 4.1 m/s2. How far downhill has the wagon gone after 2.7 s ?

Answers

Answer:

Explanation:

Given parameters:

Initial velocity  = 8.5m/s

Acceleration  = 4.1m/s²

Time  = 2.7s

Unknown:

Distance downhill traveled  = ?

Solution:

To solve this problem, we have to adopt the right motion equation;

          S = ut + [tex]\frac{1}{2}[/tex]at²

where  s = distance

            u = initial velocity

            a = acceleration

            t = time taken

Insert the parameters and solve;

  S = (8.5 x 2.7) + ([tex]\frac{1}{2}[/tex] x 4.1 x 2.7²)

  S = 22.95 + 14.95

  S = 37.9m

Need help ASAP!! Why does the ray bend as it enters the glass

Answers

Answer:

Explanation:

because as the light shines through the glass, The glass reflects the light from different places in the glass causing the light to bend

Answer: If light enters any substance with a higher refractive index  it slows down. The light bends towards the normal line. If light travels enters into a substance with a lower refractive index it speeds up. The light bends away from the normal line.

if an engine applies a force of 600N on a 200kg scooter. what will be the change of speed? answer in m/s^2

Answers

Gr
R
R
T
T
Tictuursydyficutcicigfiyuf
R
R


The area under which of
these graphs can be used
to estimate the value of
impulse?
Graph A
O Graph B
O Graph C
Graph D

Answers

Answer:

Graph A is the Answer

which molecule has the longest bond length nitrogen, hydrogen or oxygen

Answers

Answer:

Hydrogen

Explanation: hopefully.

A person with a mass of 70 kg exerts a force of 60 N when she runs.

What is her acceleration?

Answers

Answer:

a = 0.857143 m/s2

Explanation:

a=f/m

60/70

A bird flies 1.3\,\text m1.3m1, point, 3, start text, m, end text with an average speed of 2.4\,\dfrac{\text m}{\text s}2.4 s m ​ 2, point, 4, start fraction, start text, m, end text, divided by, start text, s, end text, end fraction.

Answers

Explanation:

We are not asked what to look for, bot we can as well get the time taken by the bird to cover the distance at that speed.

Given

average speed = 2.4m/s

Distance = 1.3m

From the formula

Speed = Distance/Time

Time = Distance/Speed

Time = 1.3/2.4

Time = 0.542secs

Hence the total time covered by the bird is 0.542secs

In one of the printed docunent the unit of universal gravitational constant is given Nm2kg-2.Check its correctness for dimension analysis.​

Answers

Answer:

It is correct

Explanation:

N is a unit of force

m for distance

and kg for mass

dimension of force is MLT-2

dimension of distance is L

dimension of mass is M

then. Nm2kg-2 must be equal to [MLT-2][L2][M-2]

or, Nm2kg-2 = [M-1 L3 T-2]. --------1

force (F) = G (m1 x m2)/d2

or G = Fd2/(m1m2)

G = (MLT-2 . L2)/M-2

= M-1L3T-2. -----------2

EQN 1 = EQN 2

so given unit is correct

which is an example of a transverse wave?
A. an ultrasound that transmits sound waves
B. crowd doing the wave at a sporting event
C. the waves formed by an earthquake
D. the movement of a spring in a pogo stick ​

Answers

Answer:

b

Explanation:

it is

An example of a transverse wave is; Choice D; the movement of a spring in a pogo stick

What is a transverse wave?

A transverse wave is a wave whose oscillations are perpendicular (at right-angle) to the direction of the wave's advance.

This is in contrast to a longitudinal waves in which case the medium travels in the direction of its oscillations

String waves are an example of transverse waves because the string moves up and down at right angles to the horizontal motion of the wave.

Read more on transverse waves;

https://brainly.com/question/15531840

People have vastly different opinions on the role and responsibility of schools to provide sex education. Teenage pregnancy and sexually transmitted diseases are real problems facing our adolescent population. In some cases, the decision to engage in a sexual relationship is a life or death decision.

References:

Coon, D., Mitterer, J.O., & Martini, T. (2019). Introduction to psychology: Gateways to mind and behavior (15th ed.). Belmont, CA: Cengage Learning.

Answers

Answer: ummm is this a question?

Explanation: what I said up there ^

5. An airplane must reach a velocity of 71 m/s for takeoff. If the runway is 1.0 km long, what
must the constant acceleration be?

Answers

Answer:

final velocity 'v' = 71m/s distance 's' = 1000m intial velocity 'u' =0 therefore,using third equation of motion v^2- u^2=2*a*s 71*71=2*a*1000 a=71*71/(2*1000 a= 2.52m/s^2

Explanation:

Works by separating the different wavelengths of light, used to
determine which elements are present in a star or sample

Answers

Answer:the light from an astronomical source can consist of a continuous spectrum, an emission (bright line) spectrum, or an absorption (dark line) spectrum. Because each element leaves its spectral signature in the pattern of lines we observe, spectral analyses reveal the composition of the Sun and stars.

Explanation:

why are there no earthquake on the country ies you mentioned​

Answers

Answer:

I’m not sure bro

Explanation:

Answer:

The whole country is in a very seismic area,and they have the densest seismic network in the world, so they are able to record many earthquakes. The spares seismic instrumentation in those areas doesn't allow us to actually record all the smaller earthquakes.

Other Questions
There Are 13 Girls And 17 Boys In Juan's Math Class Girls Are What Fraction Of The Class? Boys Are What Fraction? Girls= Boys= If you are def, what language do you think in sandy has several pitchers to hold lemonade The perimeter of a triangular garden is 78 feet. Find the length of the three sides if the middle length side is 3 feet greater than twice the length of the smallest side, and the longest side is 3 feet less than 3 times the length of the smallest side. write different states of matter Which events are likely to be catastrophic to an ecosystem? Select the twocorrect answers.O A. Massive floodingO B. Steady population growthO C. Introduction of an unchecked invasive speciesD. Spring thunderstormO E. Species competition What is a "Climate system"?Pls help and if you can explain Lee's uncle is installing a new pool in his backyard. The pool is a square and has an area of 121ft^2. He decides to build a 4 ft wide deck to surround the pool. What is the outside perimeter of the deck? The small square is the pool and the deck is the big square Eukaryotic cells are differentiated from prokaryotic cellsbecause eukaryotic cells what is the value of y in the proportion? How many kilograms do you have with 100g of tortillas similarities between the Texas Declaration of Independence and the United States Declaration of Independence. PLEASEEE HELPPPPConsider the equation:4A1+302 - 2Al2O3Is this equation balanced? Why or why not? The concepts listed above were included in the United States Constitution in order to- limit the powers of government limit the powers of government copy the British system of government copy the British system of government establish a strong militia establish a strong militia put down rebellion in the western territories put down rebellion in the western territories Which actions by the British Parliament provoked the American colonies to revolt? how to say good day in spanish Which of the following is acomplete sentence?A. Since you are my friend, I feel it is safe toconfide in you.B. Although they didn't know what would comeout of that dark, forbidden looking cave in frontof them.C. Because she had cared so paitiently for thelittle crippled dog, and the bird with the brokenwing. Digest the sequences using Haelll. Person 1 GGCCTCGGCCTAGAACGGCCTAGCCG CCGGAGCCGGATCTTGCCGGATCGGC Person 2 CTGAGGCCTAAGCGATTCCCGGATATA GACTCCGGATTCGCTAAGGGCCTATAT Only these two questions, I need answers with proof! Use the diagram to answer the question. Fill in the blank for the letter given with the missing reason in the flow proof. Please help me out :(