integral of e to -x cos2x from 0 to infinity

Answers

Answer 1

The integral value of  [tex]e ^{-x cos2x}[/tex] under the given condition is 1/4.

The integral of  [tex]e ^{-x cos2x}[/tex]  from 0 to infinity can be solved using integration by parts.

Let u = cos(2x) and dv = [tex]e^{(-x)dx}[/tex].

Then du/dx = -2sin(2x) and v = [tex]-e^{(-x)}[/tex].

Using integration by parts, we get:

∫[tex]e^{(-x)cos(2x)dx}[/tex] = [tex]-e^{(-x)cos(2x)/2}[/tex] + ∫[tex]e^{(-x)sin(2x)dx}[/tex]

Now, let u = sin(2x) and dv = [tex]e^{(-x)dx}[/tex]

Then du/dx = 2cos(2x) and v =[tex]-e^{(-x)}[/tex].

Using integration by parts again, we get:

∫[tex]e^{(-x)cos(2x)dx}[/tex] = [tex]-ex^{(-x)cos(2x)/2}[/tex] - [tex]e^{(-x)sin(2x)/4}[/tex] + C

here

C = constant of integration.

Therefore, the integral of [tex]e^{(-x)cos(2x)}[/tex] from 0 to infinity is

= [tex]-e^{(0)(cos(0))/2}[/tex] - [tex]e^{(0)(sin(0))/4 }[/tex]+[tex]e^{ (-infinity)(cos(infinity))/2}[/tex] + [tex]e^{(-infinity)(sin(infinity))/4.}[/tex]

Simplifying this expression gives us:

∫[tex]e^{(-x)cos(2x)dx }[/tex]

= 1/4

The integral value of  [tex]e ^{-x cos2x}[/tex] under the given condition is 1/4.

To learn more about integral ,

https://brainly.com/question/30094386

#SPJ4


Related Questions

A child lifts a box up from the floor. The child then carries the box with a constant speed to the other side of the room and puts the box down. How much work does he do on the box while walking across the floor at constant speed? Your answer: 0 J More than 0 J More information is needed to determine the answer

Answers

0 J. When the child carries the box at a constant speed, the net force on the box is zero because there is no acceleration. Therefore, the work done by the child on the box is zero. So, the correct option is 0 J.

To determine the amount of work done by the child while walking across the floor at a constant speed, we need to consider the following terms: work, force, and displacement.

Work is the amount of energy transferred when a force is applied over a certain distance. It is calculated as:

Work = Force x Distance x cos(θ)

where Force is the applied force, Distance is the displacement, and θ is the angle between the force and displacement vectors.

When the child carries the box with a constant speed across the room, the force applied is equal to the gravitational force acting on the box (i.e., the weight of the box). However, since the force and displacement are in different directions (the force is acting vertically, while the displacement is horizontal), the angle between the force and displacement is 90 degrees.

Now, we know that cos(90°) = 0. Thus,

Work = Force x Distance x cos(90°) = Force x Distance x 0 = 0 J

So, the work done by the child on the box while walking across the floor at constant speed is 0 J.

Know more about work here:

https://brainly.com/question/25573309

#SPJ11

A candlemaker prices one set of scented candles at $10 and sells an average of 200 sets each week. He finds that when he reduces the price


by $1, he then sells 50 more candle sets each week. A function can be used to model the relationship between the candlemaker's weekly


revenue, R(x) after xone-dollar decreases in price.


R(x)


R(x)


6,000+


4,000+


6,000+


1,000+


2. 000


2,000+


2,000


2,000+


-4,000


4,000


6,000+


-6,000


Graph w


R(x)


Graph X


R(x)


6,000+


1,000+


6,000+


1,000+


2,000+


2,000


-2,000+


2,000


1,000+


4,000


-6,000


6,000


Graph Y


Graph Z


This situation can be modeled by the equation y =


x +


x +


and by graph


Next

Answers

The equation of demand of candle sticks can be modeled by

y = 14 - 0.02x while the revenue function will be xy = 14x - 0.02x².

Here we are given the information that

200 candles are sold for $10 and,

250 candles are sold for $9

Let the Price be y while the Quantity sold be x

Hence, by one unit decrease in price P, the quantity sold is increased by 50 units.

Here the slope of the function will be

(10 - 9)/(200 - 250)

= - 1/50

= - 0,02

Now we will use the formula of the equation of a straight line

(y - y₁) = m(x - x₁)

where, m is the slope and x₁ , y₁ are some point on line

Hence we get

(y - 10) = -0.02(x - 200)

or, y - 10 = -0.02x + 4

or, y = 14 - 0.02x

The revenue function will be xy = 14x - 0.02x²

To learn more about Equations visit

https://brainly.com/question/16107051

#SPJ4

Correct Question

A candlemaker prices one set of scented candles at $10 and sells an average of 200 sets each week. he finds that when he reduces the price by $1, he then sells 50 more candle sets each week. a function can be used to model the relationship between the candlemaker's weekly revenue, r(x), after one-dollar decrease in price. this situation can be modeled by the equation y =

find the exact area of a square with a diagonal of 8 inches

Answers

Answer:

(8/√2)^2 = 64/2 = 32 square inches

PLS HELP! and actually answer the question please

Answers

Step-by-step explanation:

First start with the graph of    y = | x|

  then shift it RIGHT one unit

         | x -1 |

  then shift it DOWN one unit

  y=   |x-1| -1

   

please help me answer this (can give brainliest)

Answers

a) The graph of the given lines is as attached

b) The area of the enclosed triangle is: 8 square units

How to graph linear equations?

The general form of expression of linear equations in slope intercept form is expressed as:

y = mx + c

where:

m is slope

c is y-intercept

We are given the equations as:

y = x + 5

y = 5

x = 4

The graph of these three linear equations is as shown in the attached file

2) The area of the given triangle enclosed by the three lines is gotten from the formula:

A = ¹/₂ * b * h

where:

A is area

b is base

h is height

Thus:

A = ¹/₂ * 4 * 4

A = 8 square units

Read more about Linear Equation Graphs at: https://brainly.com/question/28732353

#SPJ1

Find the probability that a randomly selected point within the circle falls in the white area. R=4 cm 2. 5 cm 3 cm 3 cm [?]% Round to the nearest tenth of a percent. ​

Answers

The probability is approximately 45.4% (rounded to the nearest tenth of a percent).

To find the probability that a randomly selected point within the circle falls in the white area, we need to find the area of the white region and divide it by the total area of the circle.

The total area of the circle is:

A = πr² = π(4 cm)² = 16π cm²

The area of the white region can be found by subtracting the area of the two semicircles from the area of the circle:

White area = A - 2(1/2π(2.5 cm)²) = 16π - 2(4.375π) = 7.25π cm²

So, the probability that a randomly selected point within the circle falls in the white area is:

P(white area) = (white area)/(total area) = (7.25π)/(16π) ≈ 45.4%

Know more about probability here:

https://brainly.com/question/30034780

#SPJ11

Evaluate the line integral, where C is the given
curve.
C
y3ds,
C: x =
t3, y =
t, 0 ≤ t ≤ 5
Please provide the right answer.

Answers

Unfortunately, this integral doesn't have a simple closed-form solution. However, you can use numerical methods or software like Wolfram Alpha or a graphing calculator to approximate the value of the integral.

We have:

y = t and ds = sqrt(9t^4 + 1) dt

So, the line integral becomes:

∫C y^3 ds = ∫0^5 (t^3)(sqrt(9t^4 + 1)) dt

Using the substitution u = 9t^4 + 1, we get du/dt = 36t^3, which means dt = du/36t^3. Also, when t = 0, u = 1 and when t = 5, u = 1126.

Substituting these values and simplifying, we get:

∫C y^3 ds = (1/36) ∫1^1126 (u-1/4)(1/2) du
= (1/72) [(u-1)^2 u^(1/2)]_1^1126
= (1/72) [(1125)^2 (1126^(1/2)) - (1)^2 (1^(1/2))]

= 3555.89 (approx)

Therefore, the line integral is approximately equal to 3555.89.
To evaluate the line integral along the curve C with the given parameterization x = t^3 and y = t for 0 ≤ t ≤ 5, we need to find the integral of y^3ds. First, we need to find the derivative of the parameterization with respect to t:

dx/dt = 3t^2
dy/dt = 1

Now, we can find the differential arc length ds, which is given by the formula:

ds = √((dx/dt)^2 + (dy/dt)^2) dt

ds = √((3t^2)^2 + (1)^2) dt
ds = √(9t^4 + 1) dt

Next, substitute the parameterization of y in terms of t (y = t) into the integral:

∫(y^3 ds) = ∫(t^3 √(9t^4 + 1)) dt, with limits 0 to 5.

Now, evaluate the integral:

∫(t^3 √(9t^4 + 1)) dt from 0 to 5.

To learn more about integral visit;

brainly.com/question/18125359

#SPJ11

Let z be a random variable with a standard normal distribution. Find the indicated probability. (Enter a number. Round your answer to four decimal places. )


P(z ≥ 1. 41) =

Answers

If you let z be a random variable with a standard normal distribution, the indicated probability is 0.0793. So, the probability P(z ≥ 1.41) = 0.0793

To find the probability P(z ≥ 1.41) for a standard normal distribution, you can use a Z-table or calculator to find the area to the right of z = 1.41.

Using a Z-table or calculator, you will find the value of P(z ≥ 1.41) is approximately 0.0793. So, the probability P(z ≥ 1.41) = 0.0793. Remember to round your answer to four decimal places.

More on probability: https://brainly.com/question/22315693

#SPJ11

What is the volume, in cubic centimeters, of a cylinder with a height of 5 cm and a base radius of 10 cm, to the nearest tenths place?

Answers

The volume of the cylinder is approximately 1570.8 cubic centimeters, rounded to the nearest tenth.

A cylinder is a three-dimensional object with two congruent circular bases that are parallel to each other. The volume of a cylinder can be calculated using the formula V = πr²h, where V is the volume, r is the radius of the base, and h is the height of the cylinder.

In this problem, we are given that the height of the cylinder is 5 centimeters and the radius of the base is 10 centimeters. By substituting these values into the formula, we get:

V = π x 10² x 5

V = 500π

To calculate the volume of the cylinder, we can use an approximation for the value of pi. Taking pi to be approximately 3.14, we can calculate the volume as follows:

V ≈ 500 x 3.14

V ≈ 1570.8

Therefore, the volume of the cylinder to the nearest tenths place is approximately 1570.8 cubic centimeters.

It is important to note that the answer is an approximation since pi is an irrational number with an infinite number of decimal places. However, rounding to the nearest tenths place provides a reasonable level of precision for this calculation.

In summary, the volume of the cylinder is 1570.8 cubic centimeters, and the calculation is based on the given values and the formula for the volume of a cylinder.

To learn more about volume of the cylinder  refer here:

https://brainly.com/question/16134180

#SPJ11

PLEASE HELP ASAP WILL GIVE BRAINLIEST


Lizzie came up with a divisibility test for a certain number m≠1: Break a positive integer n into two-digit chunks, starting from the ones place. (For example, the number 354764 would break into the two-digit chunks 35, 47, and 64) Find the alternating sum of these two-digit numbers, by adding the first number, subtracting the second, adding the third, and so on. (In our example, this alternating sum would be ) Find m and show that this is indeed a divisibility test for m (by showing that n is divisible by m if and only if the result of this process is divisible by m )

Answers

The value of m is 11, and the divisibility test states that n is divisible by 11 if and only if the alternating sum of its two-digit chunks is divisible by 11.

How to prove the divisibility test?

Let's consider the given divisibility test proposed by Lizzie. The process involves breaking a positive integer, n, into two-digit chunks and finding the alternating sum of these chunks. The alternating sum is obtained by adding the first number, subtracting the second, adding the third, and so on.

To find the value of m that makes this a divisibility test, we need to analyze the properties of this test. Let's assume that n is divisible by m.

When n is divisible by m, each two-digit chunk in n will also be divisible by m. This means that the alternating sum of these chunks will also be by m since adding or subtracting multiples of m will not change its divisibility.

Conversely, if the alternating sum of the two-digit chunks is divisible by m, it implies that each chunk is divisible by m. Therefore, if the chunks are divisible by m, the original number n will also be divisible by m.

Hence, this process indeed serves as a divisibility test for m, where n is divisible by m if and only if the result of the alternating sum of the two-digit chunks is divisible by m.

Learn more about  divisibility

brainly.com/question/21416852

#SPJ11

Evaluate the following limit. Use l'Hôpital's Rule when it is convenient and applicable. lim sin 3 X00 lim 3 Xod in ) - 0 () (Type an exact answer.) X

Answers

The overall limit is undefined as the the second limit is undefined

The given limit is of the indeterminate form 0/0 and hence we can apply l'Hôpital's Rule to evaluate it.

Applying l'Hôpital's Rule, we get:

lim sin(3x) / (3x) = lim [cos(3x) * 3] / 3 = cos(3x)

Now, we need to evaluate lim (3x)/(1 - cos(x)) as x approaches 0.

Again, this limit is of the indeterminate form 0/0, so we can apply l'Hôpital's Rule once again:

lim (3x)/(1 - cos(x)) = lim (3)/(sin(x)) = 3/0 (which is undefined)

Since the second limit is undefined, the overall limit is also undefined.

For more questions like Limit click the link below:

https://brainly.com/question/12207539

#SPJ11

Question 11 Σ Determine whether the integral is divergent or convergent. If it is convergent, evaluate it. If it diverges to infinity, state your answer as "oo" (without the quotation marks). If it diverges to negative infinity, state your answer as "-00". If it diverges without being infinity or negative infinity, state your answer as "DNE". 10 10 dc 2 6

Answers

The given integral is ∫₁₀ (10/(x-2)) dx.

The given integral is divergent and the answer is "oo".

To see why the integral is divergent, we can use the following limit comparison test:

∫₁₀ (10/(x-2)) dx ~ ∫₁₀ (1/x) dx, as x → 2.

The symbol "~" means "is asymptotic to". We can use this comparison because as x approaches 2 from the right, the function 10/(x-2) approaches positive infinity.

Now, we know that the integral ∫₁₀ (1/x) dx diverges because the improper integral of 1/x from 1 to infinity diverges. Therefore, by the limit comparison test, the original integral is also divergent.

Hence, the given integral ∫₁₀ (10/(x-2)) dx is divergent, and the answer is "oo".

For more questions like Integral click the link below:

https://brainly.com/question/22008756

#SPJ11

What is the value of x log3 x=4

Answers

Answer:

x=81

Step-by-step explanation:

Rewrite log_3 (x)=4 in exponential form using the definition of a logarithm. If x and b are positive real numbers and b≠1, then log_b(x)=y is equivalent to b^y=x.

Rewrite the equation as x=3^4

Raise 3 to the power of 4 

x=81

Find the surface area of the triangular prism. The base of the prism is an isosceles triangle.

Answers

The surface area of the triangular prism is 3152 square cm if the  base of the prism is an isosceles triangle.

What exactly is a triangular prism?

When a prism has three rectangular sides and two triangular bases, the prism is said to be triangular. It's a pentahedron. A right triangular prism has two faces and three rectangular sides. Bases refers to the triangle faces, whereas laterals refers to the rectangular sides.

We have a triangular prism, is showing in the picture:

Here  a = 25

b = 25

c = 14

h = 44

The surface area of the triangular prism is given by

  A = ah + bh + ch + 1/2√-a⁴ + 2(ab)² + 2(ac)² + -b⁴ + 2(bc)² - c⁴

  Plug all the values in the formula we get:

A = 3152 square cm

Thus, the surface area of the triangular prism is 3152 square cm if the  base of the prism is an isosceles triangle.

Learn more about triangular prism

brainly.com/question/22023329

#SPJ1

Marcia makes jewelry to sell at the artists' fair. She spends $120 to rent a stall at


the fair for the day and each piece of jewelry costs Marcia $15 in materials.


Which equation would compute the number of pieces of jewelry Marcia must sell at


the artists' fair such that the average cost per piece of jewelry would be $20?


110

Answers

The equation that can be used to compute the number of pieces of jewellery is ($120 + $15q)/q = $20 .

What is the equation?

Average cost is total cost divided by the quantity of jewellery sold.

Average cost = total cost / quantity

Total cost is the sum of fixed cost and variable cost.

Total cost = fixed cost + variable cost

The fixed cost is the cost of renting the stall. The variable cost is the cost of the materials.

Total cost = $120 + ($15 x q)

T = $120 + $15q

Average cost = ($120 + $15q)/q = $20

To learn more about cost, please check: https://brainly.com/question/25717996

#SPJ1

The Environmental Protection Agency has determined that safe drinking water should have an average pH of 7. Water is unsafe if it deviates too far from 7 in either direction.You are testing water from a new source and randomly select 30 vials of water. The mean pH level in your sample is 6.4, which is slightly acidic.The Standard deviation of the sample is 0.5.(a) Does the data provide enough evidence at a = 0.05 level that the true mean pH of water from this source differs from 7?(b) A 95% confidence interval for the true mean pH level of the water is (6.21, 6.59). Interpret this interval.(c) Explain why the interval in part (b) is consistent with the result of the test in part (a).

Answers

a. The data provided enough evidence at a = 0.05 level that the true mean pH of water from this source differs from 7

b. A 95% confidence interval for the true mean pH level of the water is (6.21, 6.59) means  about 95% of those intervals would contain the true mean pH level.

c. The estimated mean pH level of seven is not included in the interval in section (b). This is consistent with the result of the test in part (a), which also rejects the null hypothesis that the true mean pH level is 7.

(a) To test whether the true mean pH of water from this source differs from 7, we can perform a one-sample t-test. The null hypothesis is that the true mean pH is equal to 7, and the alternative hypothesis is that the true mean pH is not equal to 7.

The test statistic can be calculated as follows:

t = (sample mean - hypothesized mean) / (sample standard deviation / sqrt(sample size))

t = (6.4 - 7) / (0.5 / sqrt(30))

t = -3.07

Using a t-table with 29 degrees of freedom at a significance level of 0.05 (two-tailed test), the critical t-value is ±2.045. Since the calculated t-value (-3.07) is outside of the critical t-value range, we can reject the null hypothesis and conclude that there is enough evidence at a = 0.05 level to suggest that the true mean pH of water from this source differs from 7.

(b) A 95% confidence interval for the true mean pH level of the water is (6.21, 6.59). This means that if we were to take many random samples of size 30 from this water source, and construct a 95% confidence interval for each sample mean pH level, then about 95% of those intervals would contain the true mean pH level.

(c) The interval in part (b) does not include the hypothesized mean pH level of 7. This is consistent with the result of the test in part (a), which also rejects the null hypothesis that the true mean pH level is 7.

The confidence interval provides additional information by giving a range of plausible values for the true mean pH level, and we can see that all of the values in this range are below 7, indicating that the water is indeed slightly acidic.

For more information about confidence interval, refer to the link:

brainly.com/question/2396419

#SPJ11

For Items 6-10, the height of an object, in centimeters, is modeled by the function y = 42sin (π/10 (x-h)+ 55. Determine whether each statement is always, sometimes, or never true.

6. The period of the function is 20.

7. The maximum height of the object is 55 centimeters

8. The minimum height of the object occurs when x=0

9. The graph of the function has the midline y= 55

10. The amplitude of the function is 84.

Answers

Answer:

It's fascinating to observe how the volume of different shapes can vary based on their measurements. For instance, a cylinder with a height of 6 centimeters and radius r1 has a volume of 302 cubic centimeters. Do you require further assistance?

As for the new set of instructions, please consider the following statements:

6. Sometimes true. The period of the function is determined by the formula T= 2π/b, where b is the coefficient of x in the argument of the sine function. In this case, b = π/5, so T= 10.

7. Always true. The maximum height of the object is equal to the amplitude of the function plus the vertical shift, which is 55 centimeters.

8. Sometimes true. The minimum height of the function occurs when the sine function has a value of -1, which happens at x= h-5. So, if h= 0, then x= -5, which means the statement is sometimes true depending on the value of h.

9. Always true. The midline of the function is determined by the vertical shift, which is 55 in this case.

10. Always true. The amplitude of the function is given by A= |b|, where b is the coefficient of x in the argument of the sine function. In this case, A= 42π/5, which simplifies to 84.

MARK AS BRAINLIEST!!!

if there are 40% math's books in school library containing 1800 books in total find the number of the math's books

Answers

Answer: 720

Step-by-step explanation: 1800 x 40%

Answer:

720 math books

Step-by-step explanation:

1800×40%= 720

there are 720 math books

Jason wants to earn at least $250 each week working during the


summer.


Jason earns $6. 00 an hour babysitting.


Jason earns $7. 75 an hour working at a store.


He can work no more than 40 hours each week.


Let b equal hours of babysitting, and s equal hours working at the


store.


Which system of inequalities models the constraints?


O 6. 00b + 7. 755 2 250


b +5 s 40


O 6. 00b + 7. 75s 250


b +5 s 40


O 6. 000 + 7. 75s 40


b + s 250


O 6. 00b + 7. 75s 2 40


b + s 250

Answers

Answer:

The correct system of inequalities that models the constraints is:

6.00b + 7.75s ≥ 250

b + s ≤ 40

Explanation:

The first inequality represents the requirement that Jason needs to earn at least $250 each week. The earnings from babysitting are $6.00 per hour, and the earnings from working at the store are $7.75 per hour.

Therefore, the total earnings from both jobs can be represented by the expression 6.00b + 7.75s. This expression must be greater than or equal to $250, hence the first inequality.

The second inequality represents the constraint that Jason can work no more than 40 hours each week. The variables b and s represent the number of hours worked babysitting and working at the store, respectively.

The sum of these hours must be less than or equal to 40, hence the second inequality.

Therefore, the correct system of inequalities is:

6.00b + 7.75s ≥ 250

b + s ≤ 40

To know more about constraints refer here

https://brainly.com/question/30703729#

#SPJ11

What type of angles are 3 and 6



A. Alternate interior angles

B. Alternate exterior angles

C. Supplementary angles

D. Vertical angles

Answers

B. Alternate Exterior Angles

The city is planning a concert that is expected to bring in a crowd of about


200,000 people. The concert will be held in a public park. The city planners are thinking


about the size and shape of the space that will be needed to accommodate this


number of people.


At a much smaller yet similar event, the crowd was estimated to be about


22,000 people. At this event, the crowd was confined to an area that was roughly the


shape of a right triangle with side lengths that were approximately 300 feet, 350 feet,


and 461 feet.


Determine the appropriate dimensions of a similar space with 200,000 people.


Show your work or explain your modeling.


hallar larger

Answers

The dimensions of the larger space would be roughly 300 x 350 x 461 feet multiplied by the scaling factor of 3.01. This gives dimensions of approximately 903 x 1053 x 1388 feet.

To determine the appropriate dimensions of a space that can accommodate 200,000 people, we can use the concept of similarity.

We know that the smaller event had a crowd of 22,000 people and the area was roughly a right triangle with side lengths of 300, 350, and 461 feet. We can use the ratio of the number of people to the area to find the scaling factor.

The area of the triangle is (1/2) x 300 x 350 = 52,500 square feet.
The ratio of people to area is 22,000/52,500 = 0.42 people per square foot.

To accommodate 200,000 people, we need an area of 200,000/0.42 = 476,190.5 square feet.

Assuming we maintain the same shape and proportions, we can use the area of the triangle as a guide to find the dimensions of the larger space. Let x be the scaling factor. Then:

(1/2) x (300x) x (350x) = 476,190.5
52,500x² = 476,190.5
x² = 9.05
x = 3.01

In summary, we can use the ratio of people to area to determine the appropriate dimensions of a space that can accommodate 200,000 people. By maintaining the same shape and proportions of a smaller event, we can find the scaling factor needed to determine the dimensions of the larger space.

To know more about scaling factor click on below link:

https://brainly.com/question/30215044#

#SPJ11

Find the length of the entire perimeter of the region inside r = 7 sin Ф but outside r = 2.

Answers

To find the length of the entire perimeter of the region inside r = 7 sin Ф but outside r = 2, we first need to determine the boundaries of the region.

The equation r = 7 sin Ф represents a curve that forms a flower-like shape, while the equation r = 2 represents a circle with radius 2.

To find the region inside r = 7 sin Ф but outside r = 2, we need to find the points where these two curves intersect.

Setting the two equations equal to each other, we get:

7 sin Ф = 2

Solving for sin Ф, we get:

sin Ф = 2/7

Using a calculator, we can find the two values of Ф that satisfy this equation to be approximately 0.304 and 2.837 radians.

Thus, the region inside r = 7 sin Ф but outside r = 2 is bounded by the angles 0.304 and 2.837 radians.

To find the length of the entire perimeter of this region, we need to integrate the length element around this curve:

L = ∫(from 0.304 to 2.837) √[r² + (dr/dФ)²] dФ

Using the equation r = 7 sin Ф, we can substitute and simplify the expression under the square root:

L = ∫(from 0.304 to 2.837) √[49sin²(Ф) + 49cos²(Ф)] dФ

L = ∫(from 0.304 to 2.837) 7 dФ

L = 7(2.837 - 0.304)

L = 16.1

Therefore, the length of the entire perimeter of the region inside r = 7 sin Ф but outside r = 2 is approximately 16.1 units.
To find the length of the entire perimeter of the region inside r = 7 sin Ф but outside r = 2, we must first identify the points of intersection between the two curves.

1. Set the equations equal to each other:
7 sin Ф = 2

2. Solve for Ф:
sin Ф = 2/7
Ф = arcsin(2/7)

Now, we must determine the length of the perimeter of each curve in the region of interest:

3. Length of the perimeter of r = 7 sin Ф (half of the curve, since it's within the specified region):
For a polar curve r = f(Ф), the arc length L is calculated using the formula L = ∫√(r² + (dr/dФ)²) dФ.

In this case, f(Ф) = 7 sin Ф, so dr/dФ = 7 cos Ф. Integrating over the range [0, arcsin(2/7)], we can find the half-length of this curve.

4. Length of the perimeter of r = 2 (portion of the circle outside the region):
Since we know the points of intersection from step 2, we can find the central angle of the circular segment using Ф. The central angle is 2 * arcsin(2/7), and the circumference of the circle is 2π * 2. The portion of the perimeter is given by the ratio of the central angle to 2π, multiplied by the circumference.

Finally, add the lengths obtained in steps 3 and 4 to get the total length of the entire perimeter of the region.

learn more about perimeters here:brainly.com/question/13554777

#SPJ11

Area of parallelograms, quadrilaterals and polygons - tutorial - part 2. level f
ft
what is the area of the first triangle?


1 ft
1ft
1ft
3ft
4ft

Answers

The area of the first triangle is 0 square feet.

To find the area of the first triangle with the given side lengths of 1 ft, 3 ft, and 4 ft, you can use Heron's formula.

Calculate the semi-perimeter (s) of the triangle:
s = (a + b + c) / 2
where a, b, and c are the side lengths of the triangle.
s = (1 + 3 + 4) / 2 = 8 / 2 = 4 ft

Apply Heron's formula to find the area (A) of the triangle:
A = √(s * (s - a) * (s - b) * (s - c))
A = √(4 * (4 - 1) * (4 - 3) * (4 - 4))
A = √(4 * 3 * 1 * 0)
A = √0 = 0

The area of the first triangle is 0 square feet. This means that the given side lengths do not form a valid triangle, as two sides' lengths (1 ft and 3 ft) do not add up to be greater than the length of the third side (4 ft).

Learn more about "triangle": https://brainly.com/question/17335144

#SPJ11

One tire manufacturer claims that his tires last an average of 44000 miles with a standard deviation of 7650 miles. A random sample of 120 of his tires is taken. What is the probability that the average of this sample of tires will last longer than 45000 miles

Answers

The probability of a randomly selected tire from this sample having a lifespan greater than 45,000 miles is approximately 0.0639 or 6.39%.

We can use the central limit theorem to approximate the distribution of the sample mean.

In this case, the population mean is 44,000 miles and the population standard deviation is 7,650 miles. We are taking a sample of 120 tires, so the standard deviation of the sample mean is:

σ/√n = 7,650/√120 = 698.68

To find the probability that the sample mean will be longer than 45,000 miles, we need to standardize the sample mean using the formula:

z = (x - μ) / (σ / √n)

where x is the sample mean, μ is the population mean, σ is the population standard deviation, and n is the sample size.

Plugging in the values, we get:

z = (45,000 - 44,000) / (7,650 / √120) = 1.527

We can then look up the probability corresponding to a z-score of 1.527 in a standard normal distribution table or using a calculator. The probability of a randomly selected tire from this sample having a lifespan greater than 45,000 miles is approximately 0.0639 or 6.39%.

To learn more about probability, click here:

https://brainly.com/question/30034780

#SPJ11

The radius of a circle is 7 centimeters. What is the circumference. Round the answer to the nearest hundredth

Answers

Answer:

43.96 cm

Step-by-step explanation:

Given

Radius ( r ) = 7 cm

To find : Circumference of Circle

Formula

Circumference of Circle = 2πr

Note

The Value of π = 3.14

Circumference of Circle

= 2πr

= 2 × 3.14 × 7

= 43.96 cm

Answer:

Not Rounded: 43.9822971503

Rounded: 44

Step-by-step explanation:

r= radius

2[tex]\pi[/tex]r

2[tex]\pi[/tex](7)

= 43.9822971503

Suppose the area of a trapezoid is 126 yd?. if the bases of the trapezoid are 17 yd and 11 yd long, what is the height?
a 4.5 yd
b. 9 yd
c. 2.25 yd
d. 18 yd

Answers

The height of the trapezoid is 9 yards. Therefore, the correct answer is option b. 9 yd.

To find the height of the trapezoid with the given area and base lengths, we will use the formula for the area of a trapezoid:

Area = (1/2) * (base1 + base2) * height

Here, the area is given as 126 square yards, base1 is 17 yards, and base2 is 11 yards. We need to find the height.

1. Substitute the given values into the formula:

126 = (1/2) * (17 + 11) * height

2. Simplify the equation:

126 = (1/2) * 28 * height

3. To isolate the height, divide both sides by (1/2) * 28:

height = 126 / ((1/2) * 28)

4. Calculate the result:

height = 126 / 14

height = 9

For more about height:

https://brainly.com/question/10726356

#SPJ4

What is the vertex of the graph of the equation Y=3x2( to the second power) +6x+1
A.(-1,-2)
B.(-1, 10)
C.(1, -2)
D.(1, 10)

Answers

Answer: To find the vertex of the graph of the equation Y=3x^2+6x+1, we can use the formula:

x = -b/2a

where a = 3 and b = 6, which are the coefficients of the x^2 and x terms, respectively.

x = -6/(2 x 3) = -1

Substituting x = -1 into the equation, we get:

Y = 3(-1)^2 + 6(-1) + 1 = -2

Therefore, the vertex of the graph is (-1, -2), so the answer is A. (-1,-2).

Step-by-step explanation:

The function f(t)=350(1. 2)^{365t}f(t)=350(1. 2)


365t


represents the change in a quantity over t years. What does the constant 1. 2 reveal about the rate of change of the quantity?

Answers

The constant 1.2 in the function represents the rate of change of the quantity per year.

Specifically, it represents the factor by which the quantity grows or decays over a year.

Since 1.2 is greater than 1, the function describes an exponential growth, where the quantity is multiplied by 1.2 each year.

For example, after one year, the quantity is multiplied by 1.2, after two years it is multiplied by 1.2 squared, and so on.

To know more about exponential growth refer here:

https://brainly.com/question/12490064

#SPJ11

What is the slope of the line?​

Answers

To find slope you will use rise over run

Determine if the expression zx^3/9-x^3 is a polynomial or not. if it is a polynomial, state the type and degree of the polynomial.

Answers

This expression is not a polynomial, and it doesn't have a type or degree.

The expression zx^3/9-x^3 can be simplified as:

zx^3/(9-x^3)

This expression is not a polynomial because it contains a variable (x) in the denominator, which makes it a rational expression.

A polynomial is an expression of one or more terms involving only constants and variables raised to positive integer powers, with no variables in the denominators.

Therefore, this expression is not a polynomial, and it doesn't have a type or degree.

To know more about polynomial refer here:

https://brainly.com/question/11536910

#SPJ11

Other Questions
Given cards with the letters A, B,C, and D, how many differentorders can you place the fourcards? Radikha married --------- Rajkumar Three vertices of parallelogram wxyz are w(-5,2), x(2,4), and z(-7, -3). find the coordinates of vertex y.the coordinates of vertex y are Based on the information in the picture and text write three questions about rationing and its relationship to life on the home front in American during world war 2 Convert the following circuit using NAND Question 11(Multiple Choice Worth 2 points) (Line of Fit MC) A scatter plot is shown on the coordinate plane. scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4 Which of the following graphs shows a line on the scatter plot that fits the data? scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 2 and 2 comma 3 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 2 and 8 comma 4 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing close through the coordinates at about 2 comma 3 and 8 comma 5 scatter plot with points at 1 comma 2, 2 comma 3, 3 comma 2, 4 comma 5, 5 comma 3, 5 comma 6, 6 comma 4, and 8 comma 4, with a line passing through the coordinates 1 comma 3 and a half and 2 comma 3 and a half . let u = , v = . find u + v. (1 point)how to find find u+v? Approximately ____ percent of professionals working on virtual teams have never met their teammates in person, Mutiple Choice a 25 b 40 c 75 d 90 Lines AC and DB intersect at point W. Also, mDWC=138. PLEASE HELP TY What is the central idea of this poem?Women must be happy in order to enjoy protection.When protected, women experience total happiness.Religious customs, like the Pardah, lead tohappiness.No one, no matter how protected, can escape thesorrow in life. Compare Zora Neale Hurston's Sweat with Spunk For an experiment, Bea recorded how much each of 14 seedlings grew in one month. She made a line plot to show the data. Which value occurred most often? Anyone know how to solve this? Can anybody help me ASAP 98. How many start codons are there?99. How many stop codons are there?100.101. The process of translation takes place in the102. Replication and Transcription both take place in theSecond baseFirst baseUGUUUUUCUUAUUGCUUCUCCUACUGsignals the end of the process ofGUUGUCGUAGUGlek ne(LewAUUAUCAUAAUG theone (Met)(ke)ne(Val)UCUUCCUCAUCGCCUCCCCCACCGACUACC theACA(MhviACGGCUGCCGCAGCGAlaUAUUACUAAUAGAAUAACCAU histidineCACCAACAG6AAAAAGGAUGACtyfouneGAAGAGSTOPgutamineof the cell.(Avilboneof the cell.UGUUGCUGAUGG tryptophan (1)CGUCGCCGACGGAGUAGCAGAAGGpart and GGUGGOGGAGGGKVMargune(Arg)(Gly)DYSCU3Third baseGC when an investor compares their required return to the expected return on an investment, they are utilizing the explain in 100 words Compare the similarities between Capitalism and Socialism. Garcia Co. Sells snowboards. Each snowboard requires direct materials of $112, direct labor of $42, and variable overhead of $57. The company expects fixed overhead costs of $659,000 and fixed selling and administrative costs of $125,000 for the next year. It expects to produce and sell 11,200 snowboards in the next year. What will be the selling price per unit if Garcia uses a markup of 10% of total cost find the next three terms in the sequence 3/4, 1/2, 1/4, 0 Acme corp. is a leading provider of radios to the commercial market. its products all rely on printed circuit-board technology. acme has protected its market leadership with continued advancements in this technology, which it patents. a competitor has developed a radio for this market with equal performance but uses a software-based technology instead of circuit boardsis acme's technology leadership(compeptitive advantage) sustainable? why/ why not (what capability tests does acme's technology leadership fail?)