How can scientists tell if the cells aren’t alive anymore?

Answers

Answer 1
There are many ways that a scientist can tell if cells aren’t alive anymore.

One example of this is by figuring out if a cells membrane has been damaged- cells with damaged membranes are usually considered dead because the membrane is key for the cells survival.

They usually find this out by using a cell-impermeant DNA binding dye like propidium iodide. If the membrane is intact then the dye can’t enter the cell because the membrane will act like a barrier. A damaged membrane will allow the dye to get through, proving that the cell is dead.

Hope this helps to some degree :)
Answer 2
Looking to see if the cell membrane is damaged or using a cell impermeable DNA binding dye

Related Questions

Provide a list of 5 ways you are going to stay focused and motivated to help you achieve this goal.

Answers

Answer:

Stay focussed

Explanation:

•Understand your why.
•Define your goal.
•Create a clear vision.
•Produce a plan.
•Look for the bigger picture.
•Keep it positive.
•Approach tasks in new ways.
•Break goals into manageable tasks.

Read the NEWSELA article (in the assignment attachments) and answer the THREE Multiple Choice questions:
2. Which of these statements would be MOST important to include in an objective summary of the article?
A. In the midst of providing guidelines on an unprecedented pandemic, the CDC updated its tips to prepare for another extreme occurrence: A zombie apocalypse.
B. While the CDC says it began as a "tongue-in-cheek campaign," it actually is a practical guide for any emergency, like hurricanes, earthquakes or floods.

C. The first step is to prepare for zombies – or any disaster: Create an emergency kit with essentials to last a few days.
D. This includes identifying the types of emergencies possible in your area – such as a tornado or an earthquake – to prepare for that situation and make a list of your emergency contacts.
Article The CDC wants you to prepare for a zombie apo calypse (Yes, you read that right)” here is the article
If zombies were to start roaming the streets – yes, we said zombies – the Centers for Disease Control and Prevention wants you to be prepared.
In the midst of providing guidelines on an unprecedented pandemic, the CDC updated its tips to prepare for another extreme occurrence: A zombie apocalypse.
While the CDC says it began as a "tongue-in-cheek campaign," it actually is a practical guide for any emergency, like hurricanes, earthquakes or floods.
"You may laugh now, but when it happens, you'll be happy you read this," the CDC wrote on its website. "And hey, maybe you'll even learn a thing or two about how to prepare for a real emergency."
So, what would happen if zombies were to start roaming the streets?
The CDC says it would conduct an investigation, as it would for any disease outbreak, and provide assistance to states. Until it could determine the cause of the outbreak and how it could be treated and stopped, the CDC listed guidelines to follow to be "safer than sorry."
The first step is to prepare for zombies – or any disaster: Create an emergency kit with essentials to last a few days.
The kit should include a gallon of water per day for each person; nonperishable food items; medications; tools and supplies; sanitation and hygiene products; clothing and bedding; important documents and first aid supplies, the CDC says.
Next, you should create an emergency plan for when a zombie, or a hurricane, is outside your door.
This includes identifying the types of emergencies possible in your area – such as a tornado or an earthquake – to prepare for that situation and make a list of your emergency contacts. You should also pick a place to evacuate to and make an evacuation plan, which includes a designated meeting place for you and those you live with to regroup.
This blog is especially relevant given the pandemic and last month's extreme winter weather in Texas that caused 4 million people to go without power for days. Texans – and the state's power grid – were unprepared for freezing temperatures and heavy snowfall, leaving many stranded and helpless without power and water.
The CDC blog, which was originally posted in 2011, received 1,450 comments, most of which praised the agency for its creative approach to disaster preparedness.
"It presents a disaster in a manner that I can actually entice my family into discussion; and it will provide some assistance for any potential disaster as well," wrote commenter Shellabella.
"While I have yet to meet a zombie, I have been through a couple of power outages," another comment read.
Disaster experts seem to agree about the effectiveness of this campaign.
"I think it's great," John Sellick, a professor in the Jacobs School of Medicine & Biomedical Sciences at the University at Buffalo, told Yahoo Life. "As we've seen with coronavirus, disaster preparedness is crucial."

Answers

C the first step is to prepare for zombies
CDC tongue campaign practical emergency zombie apocalypse ‍♀️ extreme hurricanes

EXPERT HELP: Which one is not a name of a fractured bone?

A. simple

B. compound

C. closed

D. open

E. swirl

Answers

The answer to your question is simple it is classified if a bone was fractured but isn’t an actual fracture thanks! Hope it helps
Try open cause a broken bone wouldn’t be open

"What they had done was just for fun.” (armed robbery, gun involed.) which “means a possible sentence of three to ten years.” Do you feel that this is a reasonable punishment? Defend your answer.

Answers

Answer:

no

Explanation:

they committed a criminal offence and them 'having fun' isnt a justifiable excuse leading to a reduced sentence. they should be punished for the expected serving time

The punishment is reasonable as what they did was not just for fun its very dangerous.

Fitness 6th Grade
Who is in charge of the game?
A. The referee
B. The coach
C. The players
D. The opponents

Answers

The referee is mainly in charge of the game because they enforce rules and stuff
The answer is The referee! A

Complete the Circuit Training Program in the knowledge article. Read the directions and study the pictures of the exercises before you begin. You will start by taking your initial heart rate and end with stretching. Try to do three full circuits for this activity. When you’re through with the program, answer the questions that follow.

Part A
How has your body physically responded up to this point in the training program?

1. Don't use me for points pls so think about it before you answer
2. Don't comment bullying comment's, things that will hurt people, mean thing in general that are considering bullying
3. Don't cause harassment against people to answer a question I post if they comment they might can help

Answers

Answer: It was completely exhausted. These training programs aren't meant for anyone with a low fitness level, it kicked my butt and i kinda struggled through the last bits of it.

Explanation:

I hope this will help you

What are the small intestines responsible for?

Answers

1234567890kskskskdjdididosose

Answer:

The small intestines are for absorption of nutrients, salt and water

what is two words to say main haha

Answers

Answer:?

Explanation:

Answer:

leading

foremost

Explanation:

yww :)

Hey guys this may seem personal but.. think about a time in your life when you were grateful for a new opportunity or for a second chance.

Answers

Answer: I got a second chance because I was framed of something I didn't do. I explained it and I got a second chance. I am really grateful that they listened and believed me.

Answer:

Thank you!

I have been going through C-vid and all. I haven't seen a friend for a year, i mean i guess we still have facetime but it is really hard sometimes. But something that is happy that is happening is that i am going to school for 4th quarter!!!!!!!And i dont even want to go to school because of the social interactions but i REALLY wanted to go to school for the learning experience. Also, i know i could have it worse.

WOW, this got deep.

WHAT WOULD YOU DO: Jeff is an 11-year-old boy. He is hanging out with a group of friends and he hears someone use a derogatory racial slur directly towards a mutual friend that is not present.

Answers

Answer:

Well in short I would tell that friend that what he said wasn't nice and that he shouldn't say it again, I would also inform an adult of these unwise actions so he may be held accountable for them.

Hope this helps!

All the love, Ya boi Fraser

I would tell jeff to let that friend know to not be talking about his mutual friend because he wouldnt want anyone using that type of language on him

Which of the following BEST describes the relationship between alcohol and fermentation?
A. Fermentation refers to how quickly grains, fruits, and yeast break down into liquid substances, which can then be used to make alcohol.
B. Fermentation is a process that uses substances such as bacteria or yeast to change the sugars of fruits or grains into alcohol.
C. Fermentation is the process in which sugars are extracted from fruits, vegetables, or grains and then transformed into alcohol, using bacteria.
D. Fermentation is the process in which fruits and grains are mixed with an alcoholic beverage to produce a new flavor.


please help

Answers

Answer:

it's b I'm sure of it

The answer to your question would most likely to be B is not I apologize

EXPERT HELP:
What is a bone fracture?

A. broken bone

B. healed bone

C. tender bone

D. weak bone

Answers

Answer:

A

Explanation:

Answer:

Its A

Explanation:

A bone fracture is a medical condition where the continuity of the bone is broken.

tis may seem personal but think about the people in your life who depend on you to succeed in life, and would be most disappointed in you if you let them down. Think about who these people are, what they expect from you, and how they will feel when you succeed.

Answers

Hope u have a good day
Thank you for this have a good day

SOMEONE HELP ME PLZZZ!!!!!!!!!

Answers

panic disorder is when someone is scared to have a panic attack, the symptoms are chills, sweating, hot flashes, shaking, and etc. possible treatments are medication, recognize that you're having a panic attack, and close your eyes. (Hope this helps!!)
Amnesia refers to the loss of memories, such as facts, information and experiences. Though forgetting your identity is a common plot device in movies and television, that's not generally the case in real-life amnesia. Instead, people with amnesia — also called amnestic syndrome — usually know who they are. But, they may have trouble learning new information and forming new memories.

"What they had done was just for fun.” (armed robbery, gun involed.) which “means a possible sentence of three to ten years.” Do you feel that this is a reasonable punishment? Defend your answer.

Answers

Answer:

yes

Explanation:

they have put someones life at risk. it doesn't matter the reason as to why they have done it. that sentence is more than reasonable.

Answer:

yes

Explanation:

this is a reasonable punishment because gun involved and armed robbery is extremely dangerous to everyone and they both can cause deaths to anyone. And it harms you and citizens both.

I'll mark you brainliest if your answer is correct

1. Why are teens more likely to suffer from addiction than an adult?

2. How do drugs change the brain making it difficult for addicts to quit?

Answers

Answer:

For one teens get addicted mostly through peer-pressure and two the brain becomes confused with whats wrong and whats right once you start and can't quit.

1. Teen brains are more malleable
2. Drugs effect the way you process thoughts

What parts of your body do you feel this activity has worked out the most? How do you know?

1. Don't use me for points pls so think about it before you answer
2. Don't comment bullying comment's, things that will hurt people, mean thing in general that are considering bullying
3. Don't cause harassment against people to answer a question I post if they comment they might can help

Answers

3 is the answer your looking for

Explanation:

Arms, shoulders, legs...

I guess!!

which two statements describe organ systems working together to remove wastes from the body?

Answers

B and C
Your welcome
b and c work together to remove waste

Does depression cause more disappointment?

Answers

Answer:

yes,yes it does.

I personally think it does.

WHAT WOULD YOU DO: Jeff is an 11-year-old boy. He is hanging out with a group of friends and he hears someone use a derogatory racial slur directly towards a mutual friend that is not present.

Answers

i would punch him :))
You educate him on how that’s not ok to use and if he doesn’t care then you tell an adult and they will handle the situation better.

This may seem personal but.. Think about the people in your life who depend on you to succeed in life, and would be most disappointed in you if you let them down. Think about who these people are, what they expect from you, and how they will feel when you succeed.

Answers

Explanation:

I think they would be happy and proud of me

Explanation:

They will be very happy for mel

have you ever felt high or drunk before and if so what was it like

Answers

being high feels like you’re swimming to me, being drunk is like a rush of happiness but then it gets depressing
being high feels like you relaxed. being drunk you feel happy and nothing matters at that time

Sinus cavities function as part of your nose
A. True
B. False

Answers

Sinus cavities do function part of you’re nose
the answer is A: true

This may seem personal but.. Think about the people in your life who depend on you to succeed in life, and would be most disappointed in you if you let them down. Think about who these people are, what they expect from you, and how they will feel when you succeed.

Answers

Answer:

Explanation:

not many to no one depends on me succeeding in fact i don't think they care

tbh there’s only about 4 people i can think of but i put everyone before me and still end up failing:)

If you could go back and change one thing what would it be?

Answers

Propably the one time I tripped over the carpet in a store and I fell into a vase and then I shattered everywhere on the floor and we had to pay 200 dollars for it and we left and my mom yelled at me and the moment we go home she smacked me with everything she had in sight

Answer/Explanation:

I think it would be my procrastination. I usually put off all my assignments and tell my self "I still have time" but it turns out I really didn't, the work starts to pile up on me but if I could go back I would break that habit before it even started.

Hope this helps :)

Harry is basically a baseline player. What strategy would you use when playing against Harry?

Answers

I would give him a short shot and make him run up because chances are if he likes baseline, he might not be as good as volleying.
I will give him a short memoir so that he forgets it

Which one is not a name of a fractured bone?
A. simple

B. compound

C. closed

D. open

E. swirl

Answers

Answer: E

Explanation:

E swirl
Is the correct answer

The endurance jump is working what muscle group?

Abdominals


Legs


Back


Arms

Answers

legs because when you jump you are focusing on strengthening your legs

The endurance jump is working with the muscle group of your legs. Thus, the correct option for this question is B.

What is an Endurance?

Endurance may be defined as the capability of an organism to exert itself and remain active for a long period of time. Apart from this, it also has the ability to resist, withstand, recover from, and have immunity to trauma, wounds, or fatigue.

When an individual is consistently performing an endurance jump, the muscle group of legs would be stretched and need more strength and activity to perform the function normally.

The process of endurance is usually utilized in both aerobic and anaerobic exercises. It is due to the fact that it has the ability to continue doing something for a long time with utmost function and property.

Therefore, the endurance jump is working with the muscle group of your legs. Thus, the correct option for this question is B.

To learn more about Endurance, refer to the link:

https://brainly.com/question/28712439

#SPJ6

this may seem personal but think about the people in your life who depend on you to succeed in life, and would be most disappointed in you if you let them down. Think about who these people are, what they expect from you, and how they will feel when you succeed.

Answers

Answer:

When necessary, We must be willing to take risks,and be prepare to lose everything.

thts how we success

Answer:

Heyy mate!!

Explanation:

Thank you for ur suggestion

2. True or False: Matter gets transformed by energy, but the same matter is still present.

Answers

True. Mstter cannot simply go away it must be transformed into a different kind of matter.0
True I believe. While matter can be changed through physical and chemical changes, the matter is still conserved. None is created nor destroyed. I think this concept is called the law of conservation mass but I could be wrong, it’s been a while since I learned about it

(Hope this helps!)
Other Questions
DQuestion 2If a right triangle has side lengths 6, 6.7 and 3, which side is the hypotenuse?O 3O 6.7O 15.706 What characteristics do Percy and his mother have in common? How do they differ? Plz help me!Plz well mark brainliest if correct! distace x time graph will be ................ if the body is in ununiform motion Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings?