Consider the figure shown. what is the measure of the given angles?

Consider The Figure Shown. What Is The Measure Of The Given Angles?

Answers

Answer 1

Step-by-step explanation:

180°=46° +2x=> 2x=134°=>x=67°

x+y=180°=>y=180° -x=>y= 180°-67°=>y=113°


Related Questions

Write an equivalent expression to
3² x 15 x 54

Answers

Equivalent Expression: 9x + 15x = 54

Step-by-step explanation:

First, yo would do 3^2 which is 3 times 3 equals 9.

So, it would be 9x + 15x = 54

Then, you combine like terms, 9x + 15x

So 9+15= 24x

Last, would be 54 = 24x

divide by 24 onto both sides and then x will be by itself and then it will give you an answer.

Answer: 2.25

Carran is building a fence around his rectangular yard. The fence will cover the front and the 2 sides of the yard. The
front of the yard is 4 feet more than twice the length of one side of the yard. The sides of the yard are the same length. If
the perimeter of the yard is 80 feet, what are the dimensions of the fence?

Answers

9514 1404 393

Answer:

sides: 12 feetfront: 28 feet

Step-by-step explanation:

Let x represent the length of one side of the yard. Then the width of the yard is 2x+4, and the perimeter is ...

  P = 2(L +W) . . . . . . . . . . formula for perimeter of a rectangle

  80 = 2(x + (2x+4)) . . . . . with values from the problem filled in

  40 = 3x +4 . . . . . . . . divide by 2, collect terms

  36 = 3x . . . . . . . . . subtract 4

  12 = x . . . . . . . . . divide by 3. This is the length of the side fence.

  2x +4 = 2(12) +4 = 28

The fence is 12 feet on the sides and 28 feet on the front. (Its total length is 52 feet.)

I need help pls, what’s the answer?

Answers

Answer:

x₂ = - 3

Step-by-step explanation:

Calculate the slope m using the slope formula and equate to [tex]\frac{5}{6}[/tex]

m = [tex]\frac{y_{2}-y_{1} }{x_{2}-x_{1} }[/tex]

with (x₁, y₁ ) = (9, 9) and (x₂, y₂ ) = (x₂, - 1)

m = [tex]\frac{-1-9}{x_{2}-9 }[/tex] , that is

[tex]\frac{-10}{x_{2}-9 }[/tex] = [tex]\frac{5}{6}[/tex] ( cross- multiply )

5(x₂ - 9) = - 60 ( divide both sides by 5 )

x₂ - 9 = - 12 ( add 9 to both sides )

x₂ = - 3

Hi please help? I am having trouble solving this.

Answers

Answer:

Step-by-step explanation:

2x+41= 127(opposite angles are equal)

2x= 127-41

2x= 86

x= 86/2

x= 43°

Rachel is a nurse she owns 12 vacation days after working 768 hours how many hours does Rachel need to work to earn one vacation day

Answers

2.6 so like 3 days........
She needs to work 64 hours to earn one vacation day.

1) Which of the following lines has an undefined slope?
A. y = 6x - 2
B. y = 3
C. y = -4x + 7
D. x = -5

Answers

Answer:

D

Step-by-step explanation:

An undefined slope (or an infinitely large slope) is the slope of a vertical line! The x-coordinate never changes no matter what the y-coordinate is! There is no run!

it cannot be written in slope-intercept form,

--So we can rule out A and B, since they are in Slope Intercept Form--

but it can be written in the form: x=a , where a is a constant.

B is not in the form x=a so we can rule that out.

D is in the correct form!

Hope i helped, Brainliest would be appreciated!

Have a nice day!

    -Aadi x

Solve for X. Plz I can't figure it outtt!

Answers

9514 1404 393

Answer:

  x = 40

Step-by-step explanation:

The angle bisector divides corresponding sides proportionally.

  x/16 = 25/10

  x = 16(25/10) . . . . . multiply by 16

  x = 40


Three cards are selected one after the other from a standard deck of 52 cards.
What is the probability that all three cards are spades if none of the first two cards is replaced?

Answers

Answer:

[tex]\frac{11}{850}[/tex]

Step-by-step explanation:

Let's see

The probability of the first card being a spade is 13/52 (as there's 13 spades in the deck.

The probability for the second card is 12/51 (because there's 12 spades left in 51 cards total).

The probability for the third is - you guessed it! - 11/50

so the total probability is:

[tex]\frac{13}{52} \cdot \frac{12}{51} \cdot \frac{11}{50} = \frac{1}{4} \cdot \frac{4}{17} \cdot \frac{11}{50} = \frac{1}{17} \cdot \frac{11}{50} = \frac{11}{850}[/tex]

A more generic solution:

Let's use the binomials to find the solution with combinations:

We need to pick 3 cards out of 13. This can be done in

[tex]\binom{13}{3} = \frac{13!}{3!\cdot10!}[/tex] ways.

And the total number of ways to pick 3 cards out of 52 is:

[tex]\binom{52}{3} = \frac{52!}{3!\cdot 49!}[/tex]

So the probability is:

[tex]\frac{ \binom{13}{3} }{ \binom{52}{3} } = \frac{ \frac{13!}{3!\cdot 10!} }{ \frac{52!}{3!\cdot 49!} } = \frac{ \frac{13!}{10!} }{ \frac{52!}{49!} } = \frac{13 \cdot 12 \cdot 11}{52 \cdot 51 \cdot 50}[/tex]

Which again brings us to the result computed before.

I WILL GIVE BRAINLIEST!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

Step-by-step explanation:

f(x) = |x - 3| + 2

g(x) = |x + 1| - 5

PLSS HELP ME ASAP!! WILL GIVE YOU BRAINLYEST!!

Elaina misses 2 free throws for every 10 attempts.
How many free throws can you expect Elaina to make
if she shoots 15 free throws in a game?

Answers

Answer:

12

Step-by-step explanation:

....................

The answer to ur equation is 12

Courtney picked 7 quarts of blueberries. She wants to share them equally among 3 of her neighbors. What fractional part of the blueberries that Courtney picked will each neighbor get? *

Answers

Answer:

7 / 1/3

Step-by-step explanation:

Anyone who helps me answer I’ll brainliest them :D

Answers

Answer:

5x -11

Step-by-step explanation:

it says it there

Answer:

a=5 c=3

Step-by-step explanation:

As a retiring employee, Khadijah receives 5% of her average teaching salary for the last five
years she worked. She receives this salary for every year of employment with the company.
Khadijah plans on retiring after 15 years with the school system and then start her own
Corporation. Her salaries for the last five years are $65,000, $70,000, $82,000, $83,000, and
$88,500. Calculate Khadijah's total retirement salary for 15 years.

Answers

Answer:

Step-by-step explanation:

Average salary = ($65,000 + $72,000 + ... + 88,500 )/5 = $77,100

5% of $77,100 = $3,855

15 years * $3,855/year = $57,825

Can someone help me on determinant

Answers

Answer:

I hope this helps you :)

A line passes through the points (0, -2) and (3, 4). Find the slope of the line.

Answers

M=2 I think so not sure

Plssss help! Find the perimeter of each polygon. Assume that lines which appear to be tangent.

Answers

Answer:

11) 75.2

12) 44.2

Step-by-step explanation:

angles formed by intersecting lines tangent to a circle are the same length.

11)

Perimeter = 2(5) + 2(12) + 2(11.4) + 2(9.2) = 75.2

12)

Perimeter = 2(4) + 2(8) + 2(5.3) + 2(4.8) = 44.2

Josephine was asked to make a one-fiftieth scale model of the new water tower for her town. She constructed the model that is shown below. A water tower has a height of 2.25 feet and diameter of 1.25 feet. Not drawn to scale What is the height of the town's new water tower in feet? Round to the nearest whole number.

Answers

Answer:

11.25 feet

Step-by-step explanation:

The model is 1/5 or 0.2 smaller than the original water tower

0.2 x water tower height = 2.25

water tower height = 2.25 / 0.2 = 11.25

Answer:

they are right but who is not excited about the fsa this year ughhhh

Step-by-step explanation:

Need help plz im really stuck

Answers

Answer:

um with what plz tell for I can help you

What are the Lateral surface and Total surface of the Triangle?

Answers

Um I’m not to sure sorry maybe someone else can help! Have a nice day! 5•8=40 remember that!

HELPP with part (b) will make brainlest !!!!!

Answers

Answer:

I dont no the answer

Step-by-step explanation:

but maybe try the app socratic

A cyclist rides her bike at a rate of 10 meters per second. What is this rate in kilometers per hour? How many kilometers will the cyclist travel in 4 hours? Do not round your answers.

Answers

Answer:

This rate in kilometers per hour is: 36 kilometers per hour. Also, the cyclist will travel 144 km in 4 hours.

Step-by-step explanation:

In order to find the rate in kilometers per hour, you have to consider that 1 meter per second is equal to 3.6 kilometers per hour and you can use a rule of three with this information:

 1 meter per second     →    3.6 kilometers per hour

10 meters per second   →                      x

x=(10*3.6)/1=36 kilometers per hour

Now, you can use the formula to calculate speed and solve for the distance:

speed=distance/time

36=distance/4

distance=36*4

distance=144 km

According to this, the answer is that this rate in kilometers per hour is: 36 kilometers per hour. Also, the cyclist will travel 144 km in 4 hours.

Which expression is equivalent to 4(x+1)-7x

Answers

4-3x

gdsyhffuussghjydxv
The answer is: -3x + 4

simplify the expression 3x -2y+6-6x+5y-8

Answers

Answer:

-3x + 3y - 2

Step-by-step explanation:

Collect like terms and add/subtract

you combine like terms

therefore the answer is -3x+3y-2

Write a point-slope equation for a line containing
the given point and having the given slope.
m = 3
(-7,2)

Answers

Answer:

y-2=3(x+7) point-slope form

Step-by-step explanation:

y-2=3(x-(-7))

y-2=3(x+7)

Help I have 10 mins.

Answers

Answer:

[tex]\sqrt{0.5}[/tex]

Step-by-step explanation:

cosx=adj/hyp

adj= [tex]\sqrt{2}[/tex]/2

hyp= r

cos(45)= ([tex]\sqrt{2}[/tex]/2)/r

[tex]\sqrt{2}[/tex]/2 = ([tex]\sqrt{2}[/tex]/2)/r

   multiply both sides by r

([tex]\sqrt{2}[/tex]/2)r = [tex]\sqrt{2}[/tex]/2

    divide both sides by [tex]\sqrt{2}[/tex]/2

r = 1

pythagorean theorem: [tex]a^{2}[/tex] + [tex]b^{2}[/tex] = [tex]c^{2}[/tex]

a = [tex]\sqrt{2}[/tex]/2

b = y

c = r = 1

[tex](\sqrt{2}/2)^{2}[/tex] + [tex]y^{2}[/tex] = [tex]1^{2}[/tex]

    [tex](\sqrt{2}/2)^{2}[/tex] = 2/4 = 0.5

0.5 + [tex]y^{2}[/tex] = 1

    subtract 0.5 from 1

[tex]y^{2}[/tex] = 0.5

[tex]\sqrt{y^{2}}[/tex] = [tex]\sqrt{0.5}[/tex]

y = [tex]\sqrt{0.5}[/tex]

A teacher gave a 3-question multiple choice quiz. Each question had 4 choices to select from. If the a student completely guessed on every problem, what is the probability that they will have 2 or less correct answers?

Answers

Answer:

0.9844

Step-by-step explanation:

This is a binomial probability problem.

Probability of getting a correct answer: p = 1/4

Probability of getting an incorrect answer: q = 3/4

Number of questions; n = 3

Thus;

probability of 2 or less correct answers is; P(x ≤ 2) = P(X = 2) + P(X = 1) + P(X = 0)

From binomial probability the formula is;

P(X = x) = C(n, x) × p^(x) × q^(n - x)

P(X = 2) = C(3, 2) × (¼)² × (¾)¹

P(X = 2) = 3 × 0.0625 × 0.75

P(X = 2) = 0.1406

P(X = 1) = C(3, 1) × (¼)¹ × (¾)²

P(X = 1) = 3 × 0.25 × 0.5625

P(X = 1) = 0.4219

P(X = 0) = C(3, 0) × (¼)^(0) × (¾)³

P(X = 0) = 0.4219

P(x ≤ 2) = 0.1406 + 0.4219 + 0.4219

P(x ≤ 2) = 0.9844

Which applies the power of a product rule to simplify (50) ?
(50) 3 - 56
(51) 3 = 3(57) - 154
(50 ° - 5373 = 1251
(50) 3 - 5 t = 1251

Answers

The answer is d. Thx ;)

A figure that has three dimensions is called​

Answers

Answer:

pyramid

Step-by-step explanation:

gooooooooooooooooooooooooooooooogle

Answer:

Answer :prisms and pyramids

What must be true about segment MN?

Answers

Answer:

The true properties of segment MN are;

1) MN is parallel to CB

2) MN = 2

Step-by-step explanation:

From the figure, we have;

The length of segment AN = 1

The length of segment NC = 2 = 2 × The length of segment AN

The length of segment AM = 1.8

The length of segment MB = 3.6 = 2 × The length of segment AM

The length of segment AC = 1 + 2 = 3

The length of segment AB = 1.8 + 3.6 = 5.4

Therefore, the length of transversal segments AC and AB are proportionally cut by the two lines, MN and CB

By the triangle proportionality theorem, two transversals are proportionally divided when they are crossed by two or more parallel lines

1) Therefore, lines MN and CB are parallel lines

Whereby we have that MN CB, we get;

ΔAMN ~ ΔABC

Therefore;

AN/AC = MN/CB

Plugging in the values, we get;

1/3 = MN/6

NM = 6 × 1/3 = 2

2) MN = 2

The length of segment CB = 6

Therefore, what must about segment MN are;

MN is parallel to CB and MN = 2.

By applying properties of similar triangles we got that MN is equal to 2 units.

What are similar triangles ?

Triangles whose shape are same are known as similar triangle .

In the given figure we can see that

in triangle  ABC and AMN

AN=1  

NC=2

So AC= AN+NC=1+2=3

AM=1.8

MB=3.6

So AB=AM+MB=5.4

[tex]\frac{AN}{NC}=\frac{1}{3} \\\\[/tex]

and

[tex]\frac{AM}{AB} =\frac{1.8}{5.4}=\frac{1}{3}[/tex]

And angle A is common in both triangles

Hence by SAS property  triangle  ABC and AMN are similar .

So

[tex]\frac{MN}{CB}=\frac{1}{3} \\\\\\\\\frac{MN}{6}=\frac{1}{3} \\\\\\\\MN=2[/tex]

By applying properties of similar triangles we got that MN is equal to 2 units.

To learn more about similar triangles visit:https://brainly.com/question/2644832

I need to know these as well- Ive been staring at my screen and I cant figure them out-

Answers

1. B and D
2. No Solutions ( I think)
3. (4, -1)
Other Questions
argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie? Which student has the greater median test score?