Which of the following is true about molecules?
1. Composed of the two same atoms

2. Composed of two different atoms

3. H2O is an example of molecule

4. All of the above is true.

Answers

Answer 1

Answer:

4) All of the above is true.

Why?

When two or more atoms chemically bond together, they form a molecule. Sometimes the atoms are all from the same element. For example, when three oxygen atoms bond together, they form a molecule of ozone (O3). If a molecule forms from atoms of two or more different elements, we call it a compound. Every combination of atoms is a molecule. A compound is a molecule made of atoms from different elements. All compounds are molecules, but not all molecules are compounds. Hydrogen gas (H2) is a molecule, but not a compound because it is made of only one element. This is because they are all made up of different types of molecules. Molecules are not only made up of different types of atoms but also different ratios. Like in the water example above, a water molecule has 2 hydrogen atoms and 1 oxygen atom. This is written as H2O.

Sorry for the long paragraph. I wanted to get my point across.


Related Questions

After an mRNA molecule is constructed from a DNA template, which statement explain what happens next? You should select all
that apply.


A)
The mRNA becomes a double stranded molecule.


B)
The mRNA brings an amino acid to the nucleus.


C)
The mRNA contains a start codon that reads AUG.


D)
The mRNA travels from the nucleus to the ribosome.


E)
The mRNA is exported from the cell through the membrane.

Answers

Answer:

C) The mRNA contains a start codon that reads AUG.

D) The mRNA travels from the nucleus to the ribosome.

Explanation:

mRNA is single stranded. The mRNA does leave the nucleus but does not leave the cell. The mRNA does not carry the amino acids, that job belongs to the tRNA and it brings them to the ribosome.

The formation of the mRNA from the DNA is called transcription. In this process, the mRNA has both the introns and the exons.

The correct option of the following question is D

The replication, transcription all process is occurs in the cytoplasm of the cell. After the process of replication, the DNA moves to the nucleus for the transcription process. The process of the formation of protein from the mRNA is called translation. The translation process occurs in the ribosomes.

The protein formation requires the ribosomes hence the RNA must be transferred to the ribosomes.

Hence, the correct option is D that is the mRNA travels from the nucleus to the ribosome.

For more information, refer to the link:-

https://brainly.com/question/15804584

When S strain bacteria were killed by being heated to 60C, then mixed with live strain bacteria and injected into mice, a greater % of
mice died than when the strain bacteria were heated to 100C. Can you propose an explanation for these observations?

Answers

Answer:

Due to live strain bacteria.

Explanation:

The first method cause more damage to the mice as compared to the second method because in the first method the killed bacteria were mixed with the live strain bacteria. This live strain bacteria causes diseases in the mice and eventually killed the mice while on the other hand, all the bacteria were killed due to very high temperature so that's why first method causes more damage than second one.

What can the people of the Earth do to change this issue?

Answers

Answer:

Whereas a change in a person may take 10-50 years to manifest itself, changes in the earth can take millions of years to become apparent. Also, humans may experience changes in their personalities as well as in their bodies, while changes in the earth are never psychological.

Why didn't Bill Stacy have blue skin even though his mother did?

Answers

Answer:

because bill stacy was sick.

Explanation:

Bill Stacy does not have blue skin even though his mother did because of variations that occur during the segregation of alleles after fertilization.

What do you mean by Variations?

Variations may be defined as the altered appearance among individuals in the same population. It is one of the factors that are responsible for maintaining diversity.

Due to variations, offspring do not identical to their parents. These variations have resulted from either erotic reproduction or mutation.

Therefore, Bill Stacy does not have blue skin even though his mother did because of variations that occur during the segregation of alleles after fertilization.

To learn more about Variations, refer to the link:

https://brainly.com/question/14926046

#SPJ2

BIO, HELP!
you know the drill, if you’re right you get the brailiest
3.
Put the cells below in the correct order for Mitosis to occur.

A-B-D-C

B-A-D-C

C-D-A-B

D-A-B-C

Answers

Answer: last answer option

Explanation:

D - prophase - you can see this by the movement of centrosomes

A - metaphase - lining of chromosomes on metaphase plate

B - anaphase - splitting of sister chromatids

C - cytokinesis - formation of 2 new cells

the correct order is D A B C

Which of the following is most effective in helping rain forest plants trap
sunlight so that light energy can be converted to chemical energy? *
Large leaf size
Small seed size
Small Stem
Large root size

Answers

Answer:

The picture was NOT a part of that question. The correct answer is Large leaf size. A

Explanation:

Leafs trap sunlight to perform photosynthesis for chemical energy which takes place in the chloroplast.

Photosynthesis is the process by which plants convert light energy into chemical energy. Plants can trap more sunlight if the size of leaves is large. Thus, the correct option is A.

What is Photosynthesis?

Photosynthesis is the process by which plants synthesize their food in the form of carbohydrates (sugars). This process takes place in the chloroplast of cell. It contains chlorophyll pigment. This pigment is responsible for trapping sunlight.

There are more chloroplast present on the leaf surface than other parts of cell. This organelle is responsible for the synthesis of carbohydrates in plants as they trap sunlight which is converted into chemical energy. The more the number of chloroplast in the cell, more will be the rate of photosynthesis in plants.

Therefore, the correct option is A.

Learn more about Photosynthesis here:

https://brainly.com/question/1388366

#SPJ6

Explain why the genes make the cell growth controller. The protein synthesis indicator and the DNA repair protein are active in all the cells.

Answers

Answer:

man im not sure

Explanation:

Which option would be a good course of action in the followingscenario?
An agronomist discovers that the plants in a field are all infected with a fungus.
A. immediately apply a fungicide
B. do nothing
C. test the fungus to determine if it is beneficial to the plants
D. burn the crop before the infection spreads to other fields

Answers

Answer:

C. test the fungus to determine if it is beneficial to the plants

Explanation:

Some fungi are  good so it's good to check and see what effect it has on the plants.

Answer: test the fungus

Explanation:

just did it edge 2021

Glucocorticoids are steroid hormones that control cellular responses through several different signaling pathways. One of the signaling pathways involves the glucocorticoid receptor, an intracellular protein that is activated by binding to a glucocorticoid molecule. A simplified model of the glucocorticoid receptor signaling pathway is represented in Figure 1.
Which of the following statements best predicts the effect of a mutation that results in a loss of the glucocorticoid receptor’s ligand binding function?

Answers

Answer:

The answers are A and B.....

help is very much appreciated <3 (7th grade science)

Answers

Answer:

1. N/A

2. a cell

3. organ system

4.Tissues are groups of similar cells that have a common function. While an organ is a structure that is composed of at least two or more tissue types and performs a specific set of functions for the body.

5.

nervous system - The nervous helps the whole body communicate, our body needs to communicate so we can actually do things like breathing.

respiratory system - The respiratory system gives cells the oxygen they need to survive, and cells keep humans alive. Humans cannot survive without breathing.

digestive system - The digestive system is important for breaking down foods into nutrients, those nutrients are then used to heal and nourish the human body. The digestive system also helps us pass toxic wastes that build up in our bodies, so we don't get sick.

--------------

hope this helps :)

Why do hooked seeds spread better than seeds without hooks

Answers

Answer:

Explanation:

Seed has been designed with all sorts of hooks, barbs and sticky gels to provide a good hold on free transportation. ... The seeds' small silky hairs provide feathery parachutes, so a good wind or a good blow can send out for quite some distance.

Answer:

they can get farther and can reach down farther to get the best soil

Explanation:

How do the laws of genetics (discovered by Mendel) govern what variations can and cannot be
possible in the offspring of any 2 sexually reproducing organisms? (List and define each of the 3 laws as
you answer this questions

Answers

The Mendel's laws of inheritance include law of dominance, law of segregation and law of independent assortment.

Some of the key elements of Mendel’s original model were:
Heritable traits are determined by heritable factors, now called genes. Genes come in pairs (that is, are present in two copies in an organism).
Genes come in different versions, now called alleles. When an organism has two different alleles of a gene, one (the dominant allele) will hide the presence of the other (the recessive allele) and determine appearance.
During gamete production, each egg or sperm cell receives just one of the two gene copies present in the organism, and the copy allocated to each gamete is random (law of segregation).
Genes for different traits are inherited independently of one another (law of independent assortment).

What occurs in the brain (with regard to our muscles) as we train and even as we sleep?​

Answers

Is this a multiple choice question??


While walking through a rainforest, a zoologist spots a colorful organism growing on a dead tree stump. Further examination reveals this organism is a
multicellular organism, possesses a nucleus, and has cell walls but no chloroplasts. The zoologist would most likely place this organism into which kingdom?
O A Plantae
OB. Decomposers
C. Prokaryotes
OD. Fungi

Answers

Answer:

D:fungi

Explanation:

The zoologist would most likely place this organism into Fungi kingdom. The correct option is D.

What is kingdom Fungi?

Any member of the eukaryotic group of organisms, which also includes the more well-known mushrooms and microbes like yeast and mould, is referred to as a fungus.

Eukaryotic creatures known as fungi include yeasts, moulds, and mushrooms as well as other microbes.

These organisms fall under the category of fungus. The creatures that make up the Kingdom Fungi are pervasive and have a cell wall.

As a biologist notices a vibrant organism sprouting on a stump from a dead tree.

A closer look reveals that this organism is multicellular, contains a nucleus, cell walls, but no chloroplasts. He probably would have put this organism in the kingdom of fungi.

As prokaryotes and decomposers are not having the characters given by the zoologist and plant also possesses chloroplast, so it can come under Fungi Kingdom.

Thus, the correct option is D.

For more details regarding kingdom Fungi, visit:

https://brainly.com/question/11829903

#SPJ6

Produces what a plant needs to use to stay alive

Answers

Plants, like all living organisms, have basic needs: a source of nutrition (food), water, space in which to live, air, and optimal temperatures in order to grow and reproduce. For most plants, these needs are summarized as light, air, water, and nutrients (known by the acronym LAWN).

Which best defines cloud computing?
оооо
Using a cloud to display the weather
Services, applications, or storage accessed via the Internet
A business propagated using the Internet
A portion of the Internet
.
PLSS HELPPPPPP

Answers

I think the best defines is the third one

What are some advantages of asexual reproduction when compared to sexual reproduction? What are some disadvantages of asexual production when compared to sexual reproduction

Answers

Answer:

produces genetic variation in the offspring.

the species can adapt to new environments due to variation, which gives them a survival advantage.

a disease is less likely to affect all the individuals in a population.

Were invertebrates more common? Did most organisms live on land or in the sea?

Answers

Answer:

Yes, invertebrates are common than vertebrates. Most organisms started off in the sea, then adapted to live on land.

Explanation:

In the past, the first animals were mostly invertebrates and lived in the water for a certain amount of time. Then, they developed the right body parts to be able to live on the land.

Answer:

invertebrates are animals with no backbone.

When a new viral infection appears in a population,scientists usually try to develop a vaccine against the virus. Which substances would most likely be contained in the new vaccin

Answers

Answer:

Antigen, stabilizers, surfactants, diluents, preservatives

Explanation:

Antigen: This is part of the protein structure virus or part of its genetic material. These parts are active. But sometimes, the inactivated form of the virus is also included in the vaccine. Stabilizers: Avoid other chemical reactions occurring in the interior of the vaccine. Surfactants: They prevent the occurrence of sedimentation and agglutination of the elements inside the vaccine. Diluent: Used to dilute the vaccine in an appropriate concentration before being used.  Preservatives: As the word says, preservatives avoid any possible contamination of the vaccine. These elements´ use depends on the doses prepared. If it is only for one-person use, then they are not needed. But if the doses are to be used by more than one person, they need preservatives because once the vaccine is opened it is vulnerable to contamination.

Which amino acid is best represented by "CCA"? *

Answers

Answer:

Proline

Codon-Amino Acid Abbreviations

Explanation:

The diagram below shows a single animal cell with many of the cells organelles. Which structure contains the instructions for making a copy of the cell?

Answers

Answer:

The nucleus (On the image, it's the sphere in the middle)

It is the nucleus, which contains the instructions for making a copy of the cell.

What is a nucleus and its functions?

It is a double-membrane-bound cell organelle found only in the eukaryotes, which comprises the genetic material. The prime function of the nucleus is to monitor a cell's reproduction and growth. It does not only store DNA, it also performs various essential cellular procedures.

The duplication of the DNA, that is, DNA replication takes place within the nucleus of the cell. It comprises the instructions for producing two identical copies of the cell, and each cell produced will get its own set of instructions. It is also the site for the process of transcription.

Thus, the nucleus is the structure that comprises the instructions for producing a copy of the cell.

Find out more information about nucleus here:

https://brainly.com/question/9260716

Which two factors are most likely to cause a plants guard cells to open its stomata.


Please help, I was seeing different responses to this question:)

Answers

Answer: The answer is in the picture

Explanation:

espero que esto ayude <3

Hope this helps <3

please help (repost)

ACTUAL ANSWERS and braincells are required

5 How does the presence of coal on Antarctica indicate a climate change?

The discovery of a new coal deposit means people will be able to use this found fuel longer.

Coal forms from the remains of plants that lived in tropical swamps millions of years ago, Coal deposits can tell scientists what the composition of the atmosphere was in the past.

Coal is burned for fuel and it releases carbon dioxide into the atmosphere.​​

Answers

Answer:

The discovery of a new coal deposit means people will be able to use this fossil fuel longer.

Coal is burned for a fuel and releases carbon dioxide into the atmosphere.

what is a mutagen? pls

Answers

Answer:

the answer is B

Explanation:

Breaking the Code
REPLICATION:
For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results after
replication.
DNA molecule #1:
TACCGGATGCCAGATCAAATC
Complimentary DNA #1:
DNA molecule #2:
TACGGGGGCGTAACCACAACT
Complementary DNA #2:
DNA molecule #3:
TACCTGTTAAGCTACAAAATT
Complementary DNA #3:

Answers

Answer:

Complimentary DNA #1:

ATGGCCTACGGTCTAGTTTAG

Complementary DNA #2:

ATGCCCCCGCATTGGTGTTGA

Complementary DNA #3:

ATGGACAATTCGATGTTTTAA

DNA molecule 1: TACCGGATGCCAGATCAAATC, complimentary will be ATGGCCTACGGTCTAGTTTAG, for DNA molecule 2: TACGGGGGCGTAACCACAACT, complimentary will be ATGCCCCCGCATTGGTGTTGA.

What is complimentary DNA?

Humans and nearly all other species carry their genetic information in DNA, also known as deoxyribonucleic acid. The DNA of an individual can be found in almost all of their cells.

The information molecule is DNA. It contains information needed to create proteins, which are other big molecules.

These instructions are dispersed throughout 46 lengthy structures called chromosomes that are found inside each of your cells. Numerous smaller pieces of DNA, known as genes, make up these chromosomes.

Complementary sequence is a sequence of bases in a nucleic acid that can be combined to generate a double-stranded structure.

For instance, G-T-A-C is the complementary sequence to C-A-T-G, where each letter represents for a different DNA nucleotide.

The DNA sequence can be:

DNA molecule 1: TACCGGATGCCAGATCAAATC, complimentary will be ATGGCCTACGGTCTAGTTTAG.DNA molecule 2: TACGGGGGCGTAACCACAACT, complimentary will be ATGCCCCCGCATTGGTGTTGA.DNA molecule 3: TACCTGTTAAGCTACAAAATT, complimentary will be ATGGACAATTCGATGTTTTAA.

Thus, this is the complete match for the given scenario.

For more details regarding DNA, visit:

https://brainly.com/question/29767255

#SPJ2

I’ll mark as BRANLIEST!!

30 POINTS!!

Please help me!!

How does DNA change from generation to generation in asexual organisms?

1. Cloning
2.Mutation
3.Variation
4. Gene pairing

Answers

Mutation- asexual means only one parent so it would be a clone but when mutated it changes

How many valence electrons does phosphorus have?

A.6

B.4

C.5

D.3

Answers

Answer:

C: 5

Explanation:

i got it right on test.

Answer:

C.5

Explanation:

There are 5 in the Valence Shell.

DNA has four nitrogenous bases:
• ________________ that pairs with _________________ (Apple Tree)
• _________________ that pairs with _________________ (Car Garage)

Answers

Answer:

Adenine pairs with thymine

Cytosine pairs with guanine

Explanation:

The four nitrogenous bases: Adenine, Thymine, Cytosine and Guanine

Remember Apple Tree

Apple Tree = Adenine Thymine

and remember car garage

Car Garage = Cytosine Guanine

Answer:

Adenine pairs with thymine

Cytosine pairs with guanine

Explanation:

Hope this helps

A simple machine makes work
a. less, easier
b. easier, less
not
C. more, harder
d. harder, less

Answers

Answer:

easier

Explanation:

Answer: A simple machine makes work easier or less harder.

A student drew the following diagram to model the structure of a prairie
community. Which level represents short and tall grasses?

A. Level 2
B. Level 1
C. Level 4
D. Level 3

Answers

Answer: B. Level 1

Explanation:

The prairie community is dominated by the grass and vegetation cover. Thus the lower most trophic level in the prairie ecosystem are the short and tall grasses. They produce major source of biomass for the herbivores of the food chain. They consume the grasses can be designated as primary consumers of the food chain. Also the producers which are grasses which make up the large amount of biomass will provide a source of food for the consumers. They will receive 100 percent energy from the sun and they will utilize 90 percent of it to make their food by the process of photosynthesis.  Only ten percent of energy is transferred to the next trophic level.

Answer:

B level 1

Explanation:

Other Questions
IF YOU WANT POINTS HERE YOU GO!!! ANSWER THE QUESTIONS CORRECTLY AND I WILL MARK BRAINLIEST!!! ON THE THIRD PICTURE, ANSWER THE HIGHLIGHTED PARTS. BE SURE TO READ THE DIRECTION CAREFULLY!!!!!!!!! what effect does hybridization have on bonds A bowling ball has a diameter of 8.5 inches. What is its approximate volume? if the sides of a triangle are 3x, x-4, and x+2, what is the perimeter of the triangle in terms of x? What is the area of the trapezoid shown below? Help me with this!! Will mark Brainliest!!! what is the area of this figure What is the answers to 12M+7+M+20 Question 3The size of a TV is usually given by the length of the screen diagonal. If the screen dimensionsof a TV are 16 inches by 12 inches, what size is this TV?Answer Help plz Best answer will get branniest answer worth 10 points Which point of view is used in the sentence?Cecilia watched as the willow tree swayed in the breeze, wondering if it would ever be warm again. Her mother gently pattedher head as she walked by and wished Celia would cheer up(1 point)O first persono third person omniscientO third person limitedO second person The average person blinks about 9 times per minutes. At this rate, about how many blinks does the average person take in 30 minutes? Eric has 240 coins in his collection. 11\20 of his coins are pennies. 4\20 of the coins are nickels. The rest f the coins are quarters. How many of the coins are quarters? Explain how you got your answer. Please help!!Do communists believe in private property Please help I have an 5 paragraph easy due next Friday please someone help the prompt is a hero in your life who inspires you thanks!!! To be a research scientist in a food science, agricultural, or natural resources field, a person should have which degree?MDbachelorsPhD.masters Rewrite as a simplified fraction 3.16 = ? giving brainiest for correct answer !! what is 4[tex]x^{2}[/tex]-12x+9=0 Roberta is the supervisor of a fund-raising project. She notices that her team members are not able to meet the targets and they have deviated from the planned schedule. To understand the situation and the challenges that the team members are facing, Roberta wants to reach out to all the team members and establish an open communication culture. To convey her message clearly, the most appropriate way for Roberta would be to: What would need to happen for the sand on the beach to turn into a rock? Explain the necessary steps.