Take a look at the map of trails to the West. Imagine you are a settler from the East. Pick one city in theWest, and describe the path you would take to reach it. You can write your answer as a numbered list.

Take A Look At The Map Of Trails To The West. Imagine You Are A Settler From The East. Pick One City

Answers

Answer 1

Answer:

I would go to Portland, Oregon. I would follow this path:

Sail on the Missouri river until I reach Fort Hall.

Camp at Fort Hall for a night.

Cross the Snake River.

Follow the trail until I reach the Columbia River.

Explanation:

This is the answer it had.

Answer 2

Answer:

Sample Answer:

I would go to Portland, Oregon. I would follow this path:

Sail on the Missouri river until I reach Fort Hall.

Camp at Fort Hall for a night.

Cross the Snake River.

Follow the trail until I reach the Columbia River.

Explanation:

This is what the answer was but I would suggest changing up the wording so it's not exactly the same. =)


Related Questions

Which of the following
did the Colonists create,
with no imported parts,
for the Old North
Church?
Cute
A. Pipe organ
B. Pan flyte
C. Lyre

Answers

The thing that the Colonist created without using imporated parts was the Pipe Organ

In which area of the world did

Answers

Answer:

Explanation:

A

Answer:

A

Explanation:

haitian revolution

How did television change politics?



PLZ HELP!

Answers

Answer:

Everything became more widespread and people could get information alot easier

Explanation:

The House of Burgesses is considered an early model for ________.

Answers

Answer:

The House of Burgesses set a model of the first democratic government with a limited royal authority

Explanation:

The House of Burgesses gave the Americans 157 years of head start in democracy.

Which one of the fifteen executive branch departments includes the National Park Service & the Fish and Wildlife Services?

Answers

Explanation:

ministry education of scool

Which president refused Texans’ request for annexation?

Answers

Answer: President Martin van Buren

Explanation: President Martin van Buren refrained from annexing Texas after the Mexicans threatened war.

an economic turn down is called

installation buying
a recession
a boom
productivity​

Answers

The answer would be a recession

answer:recession is the answer i’m pretty sure Yea i think

HELP~!! +15 BRAINLY POINTS
(10) In what TWO countries did John Jay serve as an ambassador of the United States during the War for Independence?
Germany
Spain
England
France
Italy

Answers

The only answers I'm sure of are Spain and England

Answer:

Spain and England

Explanation:

"From 1779 to 1782, Jay served as the ambassador to Spain; he persuaded Spain to provide financial aid to the fledgling United States. He also served as a negotiator of the Treaty of Paris, in which Britain recognized American independence."

can someone help me just say yes if you are good at writing 2 page essays

Answers

Answer:

What do you mean I didn't understand you


Why did many immigrants move to Texas during Reconstruction?

Answers

Answer:

Explanation:

During the reconstruction era, many immigrants settled in Texas because the state still had public lands available. Under Congressional Reconstruction, one requirement for southern states to rejoin the Union was to ratify the Fourteenth Amendment to the U.S.

When did capitalism start becoming Europe's dominant economic system?

A. the 17th century

B. the 5th century

C. the 14th century

D. the 12th century

Answers

Answer:

i believe it was the 17th century

Explanation:

Answer:

the 14th century

Explanation: In the 14th century, people began abandoning feudalism in favor of a more capitalist economy.


The Irish scientist Robert Boyle proved that all matter is made up of ______​

Answers

Answer:

elements

Explanation:

Why might the Church be concerned about a heliocentric explanation of the universe? Why was the church concerned about scientific theories

Answers

The correct answers to these open questions are the following.

Why might the Church be concerned about a heliocentric explanation of the universe?

Because in those Middle Ages times, the Catholic Church was so powerful and forced people to believe only what the church said. The high clergy of the church punished people who dared to think otherwise under the justification that no human could be against the will of God. Those were the obscure and horrible times of the inquisition.

The Church saw the heliocentric view of the solar system as a challenge to its authority because the heliocentric view, if correct, might mean God did not put humans at the center of the universe. And that would mean losing its power.

That is why the church was concerned about scientific theories such as the Heliocentric Theory, developed by Nicolaus Copernicus.

The church did not want the scientific method to explain the natural phenomena that had been attributed to the glory of God. And that was exactly what science did, to prove the church wrong with ideas such as that it was the Earth and other planets the ones that revolved around the Sun.

What does Condemned mean? ​

Answers

Answer:

answer is

Explanation:

sentenced to a particular punishment, especially death.

In what Hemisphere is Sub-Saharan Africa located? Can someone help me please

Answers

Answer:

Sub-Saharan Africa is, geographically and ethnoculturally, the area of the continent of Africa that lies south of the Sahara. According to the United Nations, it consists of all African countries and territories that are fully or partially south of the Sahara.

Explanation:

The Sub-Saharan Africa region describes the part of the African continent situated geographically south of the Sahara and therefore comprises – according to the definition of the United Nations – 49 of the 54 African states.

A new national highway system was built during the administration of President
.
A. Roosevelt
B. Eisenhower
C. Johnson
D. Nixon

Answers

Answer:

Eisenhower

Explanation:

Eisenhower was responsible for passing the Federal Aid Highway Act of 1956 which created almost 41,000 miles of new highway.

Answer:

B). Eisenhower

Explanation:

For those with different answers.

What is the population of Canadians

Answers

37 million
if u wanna be precise, around 37,982,749

When the founding fathers wrote the declaration of independence, they stated "…. "that to secure these blessings governments are instituted among men deriving their just powers from the consent of the governed". 13. Which concept are they describing?

Answers

Answer:

They are describing the idea that government is based on the consent of the governed, which is the foundational political idea of the US.

Explanation:

The Declaration of Independence is a document drafted by the Founding Fathers of the United States. In the document they not only just wrote about their grievances against the British but also wrote about an idea form of government.

By stating "that to secure these blessings governments are instituted among men deriving their just powers from the consent of the governed," they were describing the idea that the government is based on the consent of the governed, which later became the foundational political idea of the US.

Travis is 53 3 4 inches tall. Theresa is 1 1 2 inches taller than Travis and Jane is 1 1 5 inches taller than Theresa. How tall is Jane

Answers

Answer:

Height of Jane is [tex]\frac{1129}{20}[/tex] inches

Explanation:

Height of Travis is [tex]53\frac{3}{4}[/tex] inches

Height of Theresa is equal to Height of Travis + [tex]1\frac{1}{2}[/tex]

[tex]53\frac{3}{4}[/tex] + [tex]1\frac{1}{2}[/tex]

[tex]\frac{215}{4} + \frac{3}{2} \\\frac{215}{4} + \frac{6}{4}\\\frac{221}{4}[/tex]

Height of Jane is equal to Height of  Theresa + [tex]1\frac{1}{5}[/tex]

[tex]\frac{221}{4} + \frac{6}{5} \\\frac{221*5 + 24}{20} \\\frac{1105+24}{20} \\\frac{1129}{20}[/tex]inches

what is the difference between a political map and a physical map ​

Answers

Answer:

Political Maps - does not show physical features. Instead, they show state and national boundaries and capital and major cities. Physical Maps - illustrate the physical features of an area, such as the mountains, rivers and lakes.

Answer:

Hey mate....

Explanation:

This is ur answer.....

Political Maps - does not show physical features. Instead, they show state and national boundaries and capital and major cities. 

Physical Maps - illustrate the physical features of an area, such as the mountains, rivers and lakes.

Hope it helps you,

mark me brainliest plz....

Follow me! :)

Which land ordinance is described below? The land would be surveyed into rectangular grids by scientific methods.
1.) Land Ordinance of 1784
2.) Land Ordinance of 1785
3.) Northwest Ordinance of 1787
4.) Homestead Act

Answers

Answer:

3.) Northwest Ordinance of 1787

Explanation:

sorry  if  not  right

Should the US have become an empire? How long could the US have maintained an isolationist policy toward the world?

Answers

The correct answer to this open question is the following.

Should the US have become an empire?

No of course not, because that would have been in direct opposition to the elevated ideas expressed by the United States Founding fathers when they created the US Constitution and established the new form of government during the Constitutional Convention held in Philadelphia, Pennsylvania in the summer of 1787.

Nevertheless, as it happens in the history of the nations, there were Presidents that under the idea of the Manifested Destiny tried to expand the US territory waging war, invading, and supporting imperialistic ideals, as was the case of President James Polk. It was the time of the Mexican-American War when the United States got the territories of California, Arizona, and New Mexico, Other Presidents had similar foreign policies.

How long could the US have maintained an isolationist policy toward the world?

Basically, the US developed the concept of isolationism during two important times in modern history. First, at the beginning of World War I. US President Woodrow Wilson tried to maint the foreign policy of neutrality. Years later, at the beginning of World War II, US President Franklin D. Roosevelt tried to do the same. In both cases, after terrible events, both presidents decided to enter the war.

Which best describes what military leaders in Argentina did to people who disagreed with their policies?

A) They Kidnapped them
B) They deported them
C) They threatened them
D) They ignored them.

Answers

Answer:

A) They Kidnapped them

Explanation:

i took the test

What describes the military leaders behavior in Argentina to those that disagreed with their policies is that A) They always Kidnapped them.

What is the reaction of military to those that disagree with them?

In Argentina, when the military are in power they always force people to go by their policy.

As a result of this, anyone that go against their wish are being kidnapped and tortured.

Learn more about Argentina at;

https://brainly.com/question/14336198

1. How did segregation and discrimination affect southern blacks in the 1950s?

Answers

We have to start from the beginning. After slavery was abolished blacks were still very much the “undesired” group. 1870’s, Jim Crow laws were placed to keep the blacks and whites from every using the same things ex, doors, water fountains, etc. It never stopped until 1964, when black civil rights activist came to play and demanded equality.

In the south even after segregation ended, blacks were still treated unfair and many laws were put in place to like red lining or map zoning to keep the blacks and whites separated, Wether it be a house or a job. The 1950s were no better. They were more radical and more racist hate crime is practically allowed or dismissed due to a stigma. Life was hard but those blacks who lived through it worked hard to keep going.

Which statement best completes the diagram?
Cause; ???
Effect; more Europeans move to the United States in the 1800s

Answers

Answer:

Cause: More economic developement and increase in population.

Explanation:

:)

Answer:

More economic developement and increase in population

Explanation:

what are some main points of the sacco and vanzetti chapter in the history book after the fact

Answers

Answer:

Sacco and Vanzetti were charged with the crime of murder on May 5, 1920, and indicted four months later on September 14. Following Sacco and Vanzetti's indictment for murder for the Braintree robbery, Galleanists and anarchists in the United States and abroad began a campaign of violent retaliation.

Explanation:

Why were many western cities built in the 1820s and 1830s located on large rivers

Answers

Answer:They were convenient if the source and destination were both located near a body of water, and there was a navigable waterway between the two points. Boats could easily travel carrying cargo and passengers between the two points.

Explanation:

What is the most valuable gemstone on the planet, in terms of weight?

Answers

Answer:

Emeralds

Explanation:

1) With which game is Francis Drake associated?

hurling

bowls

shinty

Answers

Answer:bowls

Explanation:

How did President Hoover try to fix the problems of the Great Depression?
A. He increased government spending on the stock market.
B. He gave veterans new benefits.
O C. He supported business.
D. He supported individuals through loans and grants.

Answers

Answer:

C. He Supported Business.

Explanation:

Who is Herbert Clark Hoover?

Herbert Hoover, in full Herbert Clark Hoover,

He was born on August 10th, 1874, in West Branch, Iowa, U.S. died on October 20, 1964, in New York, and was the 31st president of the United States from 1929-1933. Hoover’s reputation as a humanitarian earned during and after World War I as he rescued millions of Europeans from starvation faded from public consciousness when his administration could not alleviate widespread joblessness, homelessness, and hunger in his own country during the early years of the Great Depression.

Learn more about Herber Clark Hoover: https://brainly.com/question/9587577

Note To Moderators:

Don't delete this answer because I want to help everyone that I can during school hours.

President Hoover tried to fix the problems of the Great Depression by supporting businesses. He believed that if businesses were encouraged to invest and expand, the economy would recover. He worked to create public-private partnerships to encourage business investment and stimulate job creation. Thus, option C is correct.

What was the Great Depression?

The Great Depression was a severe economic downturn that lasted from 1929 to 1939. It began in the United States and quickly spread to other countries around the world, causing widespread unemployment, poverty, and hardship.

The Great Depression was triggered by a stock market crash on October 29, 1929, known as "Black Tuesday." The crash was caused by a combination of factors, including an economic boom in the 1920s that led to speculation and overproduction, and a lack of government regulation of financial markets.

As businesses failed and unemployment rise, the crisis spread to other parts of the economy, leading to a decade-long period of economic depression and hardship for millions of people.

The Great Depression had a profound impact on the world, leading to significant political and social changes, including the rise of authoritarian regimes and the welfare state.

Learn more about Great Depression here:

https://brainly.com/question/30040324

#SPJ5

Other Questions
Was there a contradiction between Balfours proposal to establish a national home for the Jewish people and the promise that nothing shall be done which may prejudice the civil and religious rights of existing non-Jewish communities in Palestine? If so, why did he make two contradictory promises? argumentative essay on genetically modified foodsCAN SOMEBODY HELP ME WITH DIS PLZZ DONT PUT ANYTHANG SLOW PLZZ help asap just give the answer Giving braileiest lollolololol What is the primary duty of a Panchayat? A local shelter is having an Adopt-a-thon for kittens and puppies. Kittens cost $50 to adopt and puppies are $75. The shelter made $1200 during the Adopt-a-thon event and adopted off twice as many puppies as kittens. Write and solve a system to find how many puppies and kittens were adopted Due to the way the Electoral College is set up, its possible to win the presidency without winning the majority of popular votes. Because of this, a debate has sprung up as to ways to possibly fix this system (assuming it needs to be fixed). What arguments can be made for getting rid of the Electoral College? What arguments could be made for keeping it as is? WILL GIVE BRAINLST HAVE AN AMAZING DAY :) Breaking the CodeREPLICATION:For each of the three DNA sequences below, write the sequence of the complementary strand of DNA that results afterreplication.DNA molecule #1:TACCGGATGCCAGATCAAATCComplimentary DNA #1:DNA molecule #2:TACGGGGGCGTAACCACAACTComplementary DNA #2:DNA molecule #3:TACCTGTTAAGCTACAAAATTComplementary DNA #3: What is the molarity of a solution that contains 2.14 moles (CH3)2SO in 2.00 L solution? Workout the following divisions. People have the right to _____. Select 3 options.associate with whomever they choosehave control over their personal informationnot have what they think and feel revealedbe told what to believe and what to buybe tracked, monitored, and identified Barbara wants to add one of the following sentences to her story. Which version of the sentence is the most descriptive? A. There were a lot of fish in the water, and Abigail could not stop herself from admiring all of them as they swam along to their destination. B. Thinking about all that she had to do, Abigail decided to take a break in her walk along the creek to admire the tons of fish silently swimming in the water next to her. C. Abigail kneeled and looked down at the water in the creek; it was so clear she could see the fish, the rocks, and the plants on the bottom. D. The gushing creek's water, pure and clear, allowed Abigail to observe the traveling school of sockeye salmon, gracefully gliding along in peaceful companionship. What is one disadvantage of using nuclear fission to produce electricity? Identify the true and false statements about the use of lithium to treat bipolar disorders. True Statement(s) In patients with bipolar II, lithium is often taken with an SSRI. Press Space to open Cognitive-behavioral training may be necessary to get clients to keep taking lithium. Press Space to open Side effects of lithium usually diminish in a few weeks. If 2 cups makes 6 servings, how much makes 2 servings? shawtys been simping for so long.. do you think hunter-gatherers are still around today? what makes you think that? Hi, I am very stuck on questions 17 and 18. Can someone help please? Thanks In which quadrant does the point with c ordinate (4, -3) lie?