A guests order a bowl of clam chowder and asks if the soup is gluten free. How should the server respond?

Answers

Answer 1

Answer:

It depends on if the restaurant that serves the clam chowder.

Explanation:

If the Clam Chowder being served is gluten free then the server should say "Yes our Clam Chowder is gluten-free is that what you would like?"

If the restaurant does not server gluten free Clam Chowder the server should respond with "No sir/ma'am the Clam Chowder is not gluten free would you like something else?"


Related Questions

Please help me with a food question

Answers

Answer:

Umm, what is the food question?

Explanation:

Uwu

The diffusion of gas inside the lungs is dependent on two liquids: water and surfactant. Without the surfactant lining the inner surface of the alveoli, what would most likely happen? (2 points)
Air would not reach the bronchioles.
Air would be trapped in the bronchioles.
The lungs would over inflate.
The lungs would lack the pressure needed to inflate.

Answers

Answer:

The diffusion of gas inside the lungs is dependent on two liquids: water and surfactant. Without the surfactant lining the inner surface of the alveoli, what would most likely happen? The lungs would lack the pressure needed to inflate.

The Lungs would lack the pressure needed to inflate .

What is lungs and its function ?

Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe. The respiratory system's main job is to move fresh air into your body while removing waste gases.

What is surfactant in lungs ?

Surfactant is released from the lung cells and spreads across the tissue that surrounds alveoli. This substance lowers surface tension, which keeps the alveoli from collapsing after exhalation and makes breathing easy.

To learn more about lungs here

https://brainly.com/question/13210870

#SPJ2

At what age does a woman stop her period, or begin menopause?

Answers

Within 40 - 50 years... Depends on the woman.

What's the difference between a drugs brand name and generic name ?

Plz help

Answers

While brand name drug refers to the name giving by the producing company, generic drug refers to a drug produced after the active ingredient of the brand name drug. Generic drugs will, however, be sold under different brand names, but will contain the same active ingredients as the brand-name drug.

yo whats a BMI and pigs can fly??

Answers

body mass index and no ‍♀️

I jus been so tired but I can't sleep at night so in the morning I sleep and get uninterested in school because I be so tired I'm 13. What do I do to?

Answers

Answer:

take a break, school isnt everything, i suggest u should go outside and take a walk maybe? that always clears my head

Explanation:

Answer

Try playing music that you like, preferably quiet and soothing tunes like J*zz or A*sthetic or Rain Noises; that's what I prefer) Stretching. You wouldn't believe how much stretching helps. It relieves you and helps you fall asleep easier.Tea or a warm glass of milk. This is pretty much the first fact that anyone sees when searching up sleep tips.Try to clear your mind. If you lie in bed and start thinking of all these thing while trying to sleep, it can clutter you up and will just make it harder and harder to sleep. Whatever way it it, try to not think about so many things during that time, if you can.Game 'til you drop. Honestly, I've had to do this countless time before. I'll just sit in bed and watch Y*utube until my eyelids start drooping. Then, I slide it away and go to sleep.

Then, there's also the possibility you may have ins*mnia. If you do, I suggest you get in contact with a d*ctor (don't know if people with that do that) r just try the things I said.

Hope this helped!

Source(s) used: N/A

What is the main responsibility of a nutritionist?

help people lose weight
help people get fat
make an exercise log to see your progress
advise people on what to eat

Answers

Answer:

Nutritionists are experts in the field of food and nutrition and help others achieve their health goals. Their duties include: Provide direction to patients/clients on healthy living and good nutrition. Implement meal plans in health facilities or schools.

Explanation:

plss follow me❤️

PLEASE HELPPPPPPPPPPP!

Answers

Answer:

They do a lot of push back.

Explanation:

When the food industry is called out for bad practices or bad ingredients they get to work to push back. Most times, they will call their lawyers and try to bring those people to court. They will also pay politician's to have them back up whatever bad practices they are doing. They will also run smear campaigns against the people as well. Overall, the food industry does not take criticism lightly and tend to try to crush any of that.

10. The glycemic index predicts the way certain foods affect
ООО
A. blood sugar levels.
B. weight loss.
C. exercise performance.
D. blood pressure.

Answers

blood sugar levels...

How is muscular dystrophy contracted?
a. through DNA
b. through a virus
c. through certain forms of cancer
4. through old age

Answers

Answer is A.Throught DNA

Select all that apply. The following career(s) spend a lot of time working with people: sales clerk semitruck drivers computer programmers hotel hospitality

Answers

Answer:

sales clerk

hotel hospitality

Crically discuss THREE links between unemployment and crime/ lack of sef esteem ​

Answers

Unemployment links to crime because 1 they have nothing else to do with their time resulting in boredom influencing behaviour that does not fit in with society. 2. They may not have the funds to access basic necessities such as food and money to keep them warm which results in them doing things that would get them into trouble in aid to feed themselves and their family. 3. Being unemployed may also have a decline in their self esteem because they may feel as if they do not make as much contribution as their peers or other family members which can also make them feel stressed if they are not able to provide as much as they would like to making them feel worthless and not significant.

Help me with food question

Answers

Answer:

1. 3

2. 15 servings

3. 45 cookies

4. 3

5. Sugar

6. 14 grams of sugar

7. 3 1/2 teaspoons of sugar

8. 2/25 teaspoons per cookie

Explanation:

Ur welcome

how can local communtiies benefits from international or global initiatives

Answers

Local communities can come together to put their help into making the world better, and if everyone puts a little in it’ll make a big difference

My life is a fishbowl

Answers

Answer:

okay

Explanation:

can you help me with my english

That’s awesome. Me too

A group of organs working together to turn food into

Answers

The answer is Digestive system :)

A patient sees an oncologist for a test. The oncologist discovers an abnormal growth of cells but cannot determine
with this test whether or not the growth will form a solid mass or if it will be malignant.
In medical terms, the abnormal growth that the oncologist has discovered would best be described as a

Answers

it would be a neoplasm. hope this helps

You have an opposable thumb. Explain what this means in your own words.

Explain in 2-3 sentences

Thank you!

Answers

Answer:

Opposable thumbs allow grasping things firmly, and can touch the other fingers. It also allows you to eat with one hand and to pick up small objects easily.

The ability to use muscle through its entire range of motion is known as

Answers

Answer:

Flexibility

Explanation:

The ability to use muscle through its entire range of motion is known as flexibility.

Flexibility is the property of being flexible. Is the quality of being adaptable or variable; “he enjoyed the flexibility of his working arrangement”.

Is the trait of being easily persuaded.

The correct answer is flexibility.

Flexibility- the ability to move a body part through a full range of motion

f r e e
p o i n t s !

Your welcome : )

Answers

O k

Explanation:

T h a n k Y o u I g u e s s :) ...

Answer:

HELL YEAH!

Explanation:

JAyWHypehEe!

graham crackers are dry

Answers

Graham cracker crusts are easy to use, whether you bake them yourself or buy them at the store, because they take a lot less prep time and quite a bit less baking time than more traditional pastry crusts do. The drawback to them is that they got soggy very easily, a problem that is usually only made worse by the fact that the fillings placed in graham cracker shells tend to be custards, puddings and creams.

Fortunately, there are a couple of quick fixes that can prevent a graham cracker crust from getting soggy. When you have a no-bake filling, such as the one on this Caramel Banana Cream Pie or this Fresh Strawberry Pie, you can line the inside of the graham cracker crust with melted chocolate. This creates a waterproof barrier between the crust and filling, and will keep the crust in perfect condition even after the pie is sliced. You can use any kind of chocolate, simply brush it on with a pastry brush (or spread it very thinly) the chill it for a few minutes to set before filling.

If you have a pie that doesn’t go well with chocolate, or one that needs to be baked with its filling already in place, there is another trick to use. This time, brush the inside of an already baked (or store bought) graham cracker crust with a lightly beaten egg white and pop it into the oven at about 350F 3-5 minutes to let it dry. The crust has to be cool before you brush in the egg white to ensure that it is firm enough to allow you to brush it. The egg white has the same effect as the melted chocolate (although chocolate is sturdier overall), keeping moisture out of the crust.

Answer:

They are. Everytime I eat one, I have to drink like 5 gallons of water. Same with chocolate.

Explanation:

What age should I be to redo my room just the way I want not what my parents want?

Answers

Answer:

I think 13 or 14 is a good age

Explanation:

not only did o get my room done at 13, but it's when you start growing like a teenager

Answer:

When you become an adult and can live on your own terms.

Oxygen is carried (delivered) to all the parts of your body in your: a.Blood b.Urine c. Muscles d. Brain e. None of the above

Answers

Answer:

Blood

Explanation:

When it passes through the lungs it picks up oxygen and brings it to the rest of the body.

PLSSS help ANYONE ????!!!

Answers

The answer is C because that’s just a good thing to do to show good sportsman shop
I am pretty sure the answer is c it sounds right

How does the heart pump blood

Answers

Answer:

Explanation:

The right ventricle pumps the oxygen-(poor blood) to the lungs through the pulmonary valve. The left atrium receives oxygen-(rich blood) from the lungs and pumps it to the left ventricle through the mitral valve. The left ventricle pumps the oxygen-(rich blood) through the aortic valve out to the rest of the body.

Hope this helped!!!

What three facts must be recorded when taking a
patient's respiratory rate?
O rate, volume, and rhythm
rate, character, and rhythm
o character, sound, and volume
O rhythm, sound, and character

Answers

I thinks it’s A but it could also probably be C. I thinks it’s A

Answer:

It's rate, character, and rhythm

Explanation:

I just did the assignment. (:

What aspect of fitness do blood pressure, heart rate (pulse), and breathing rate measure?
diet
exercise
cardiovascular fitness
stress management
(how ever answers right gets a brainly!)

Answers

Answer: cardiovascular fitness

Explanation: It measures the capacity of the heart, lungs, and blood to transport oxygen to the working muscles, and measures the utilization of oxygen by the muscles during exercise.

Teens who drink alcohol are less likely to develop alcohol dependence than individuals who wait until adulthood to began drinking?

Answers

Answer:

True

Explanation:

Teens brains are still trying to fully develop but when adults do it they already have developed brains.

False

Explanation:

Because you hurting your brain

When the spine develops an S- or C-shaped curve, this imbalance is referred to as ?

Answers

Answer:

Scoliosis

Explanation:

Scoliosis is when a person has a S- or C-curve in their spine

AYO SOMEONE HELP ME ❗️❗️

Answers

Answer:1- 1 3/4 cup

2-1 1/4 cup

3- 1/4 cup

4- 1/3 cup

5- 1 1/3 cup

6 2 cups

Explanation:

Other Questions
What is equivalent to x+y+x+y+3(y+5)? explain the major resources of energy and write its impoetance What is the fraction equivalent of 430%NO LINKS. IF WRONG I WILL DELETE. I need this plz help In romeo and juliet passage 1 line 64, what does the phrase, content thee most closely mean?A. Be satisfiedB. Be rationalC. Be stillD. Be grateful Diego bought some raisins and walnuts to make trailmix. Raisins cost $4 a pound and walnuts cost $8 apound. Diego spent $15 on both ingredients. Decide ifeach pair of values could be a combination of raisinsand walnuts that Diego bought.Explain your answer. HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes. Which states the best reason why Chapter 15 might be titled "Nest-Building"?The robin is building a nest in the garden.A nest is a symbol for a safe place where Mary and Colin can grow.The robins are a symbol for new life returning to the garden.Mary and Dickon want Colin to watch the robin building the nest. You estimate that there are 40 marbles in a jar. The actual amount is48 marbles. Find the percent error. Round to the nearest tenth of a percent. help me plz which formula should I use?? What is the pear harbor and what happened 1. When did Texas become a territory of the United States? 5 oranges are bought for $4.00 and later sold at $0.10 each .find the loss percent. What is an advantage to being ectothermic?Question 18 options:Ectothermic animals require much less energy to survive than endothermic animals. Ectothermic animals can sleep longer than endothermic animals. Ectothermic animals always live longer than endothermic animals. Ectothermic animals can live in a greater number of environments than endothermic animals.