1. Which of these was not one of the names given to the deal to purchase Alaska from Russia by those who opposed it?
A Seward's Icebox
B Sitka
C Wakrussia
D Russian Fairy Land

Answers

Answer 1

Answer:

I'd say C.

Explanation:


Related Questions

What were the features of the first state constitution?
What were the major characteristics of the Articles of Confederation?

Answers

Answer:

1.they are

.Popular Sovereignty. The principle of popular sovereignty was the basis for every new State constitution.

.Limited Government. The concept of limited government was a major feature of each State constitution.

.Civil Rights and Liberties.

2.The major features of the articles of confederation were the establishment of the confederation as 'The United States of America', and an explanation of the rights possessed by any state and the amount of power that the state were entitled to.

60 points!
The changes and continuities in the lives of African Americans during the 19th century
i need 3 things so i can write a paragraph on each

Answers

Answer:

Freedom from slavery, equal rights and citizenship.

Explanation:

Freedom from slavery, equal rights and citizenship are the changes in the lives of African Americans during the 19th century. After the civil war and completion of reconstruction phase, the African Americans were given freedom from slavery which they gain from their ancestors. They are considered citizens of United States of America and given equal rights just like white Americans in the country. We can conclude that the lives of African Americans greatly change during the 19th century.

A forest fire can have which of the following positive effects?

Answers

Answer:

It can help grass take back over, as well as melt snow in winter

Explanation:

Please give us the answer list

Answer:

heats the soil, cracking seed coats and triggering germination. triggers woody seed pods held in the canopy to open, releasing seed onto a fresh and fertile ash bed. clears thick understorey reducing competition for seedlings. encourages new growth that provides food for many animals.

Explanation:

How did world war 2 impact the United States?

Answers

Answer:

World War II had a significant impact on the economy and workforce of US .

Explanation:

The war changed the unemployment rate to 10% .

According to the briefing, what was the international response to this stage of the Cuban Missile Crisis?

Cuban airlines were grounded.
The United Nations supported military action.
Allies offered military support.
International media promoted war.

Answers

Answer:

C

Explanation:

The correct option is C. The international response to this stage of the Cuban Missile Crisis Allies offered military support.

What was the Cuban Missile Crisis?

The Soviet Union started installing missiles in Cuba covertly in 1962 in preparation for attacks on American cities. The subsequent conflict, often known as the Cuban missile crisis, nearly resulted in a nuclear exchange between the two superpowers before a deal to remove the missiles was struck.

Due to their willingness to do so, the Soviet Union could have removed missiles from Cuba. Instead, they were left with little choice but to flee the United States when it was prompted by these missiles. As a result, the United States emerged victorious from the conflict.

Learn more about the Cuban Missile Crisis here:

https://brainly.com/question/12687037

#SPJ5

What was the name given to Gorbachev policy of political openness?

Answers

the name given to Gorbachev 's policy of political openness was called 'glasnost '.

Richard Nixon used the theory of detente in
which of the following situations?
A. He negotiated the SALT I treaty with the USSR.
B. He testified in open court regarding the Watergate scandal.
C. He accepted the resignation of Vice President Spiro Agnew.
D. He resigned from office in 1974.

Answers

Answer:

Option B

Richard Nixon used the theory of detente in testifiying in open court regarding the Watergate scandal

Explanation:

Because of the Watergate scandal, Nixon was forced  to resign from the presidency. He then achieved massive landslide victory at the polls  and attempted to achieve what he lost because of the break-in at the Watergate complex thereby signifying the relationship between Nixon, his loyal White House aides, and the millions of faithful supporters.

According to Clinton, what were three ways that NFTA would affect Mexico?

Answers

Answer:

This means the economic growth is spreading in Mexico to working people, there will be more disposable income to buy more American products and there will be less illegal immigration due to having income to support their children.

Explanation:

hope i helped :)

china culture society and politics​

Answers

Answer:

Chinese society and culture (history, traditions, customs, beliefs) are very complex. Not just for westerners. Chinese people themselves have a hard time answering questions about their own culture and society. And not only in China.The politics of the People's Republic of China takes place in a framework of a socialist republic run by a single party, the Chinese Communist Party (CCP), headed by the General Secretary. State power within the People's Republic of China (PRC) is exercised through the Communist Party, the Central People's Government (State Council) and their provincial and local representation

Explanation:

In your opinion, how important are community organizations in building friendships between people of different backgrounds?

Answers

Explanation:

Building relationships with people from different cultures, often many different cultures, is key in building diverse communities that are powerful enough to achieve significant goals.

As people work on challenging problems, they will have to hang in there together when things get hard.

Which sentence contains punctuation which adds a sense of urgency to it? We must leave now. We must leave now? We must leave now! We must leave now...

Answers

“We must leave now!”

Answer:

we must leave now!

Explanation:

thats the correct answer for k-12 :) if tou need more help dont be afraid to ask me! ^^

We believe in a fair exchange. An eye for an eye. A tooth for a tooth. A head for a head and life for a
life. If this is the price of freedom, we won't hesitate to pay the price.
- Malcolm X, black activist, 1964 speech
From the passage, you can conclude that Malcolm X-
Wanted to overthrow the government
Broke away from the Nation of Islam
Agreed with the philosophy of nonviolence
Was a militant civil rights activist
d

Answers

Answer:

Was a militant civil rights activist

Explanation:

According to the given excerpt, the words of Malcolm X is quoted where he says that he believes in a fair exchange of an eye for an eye, a tooth for a tooth and a life for a life, if that was the price for freedom, it was something he was willing to pay.

Therefore, according to this excerpt, we can conclude that Malcolm X was a military civil rights activist who didn't believe in the nonviolence approach.

O
Issuance of the Emancipation Proclamation in 1863
Ratification of the 15th amendment in 1870
Od
Question 6 (1 point)
We believe in a fair exchange. An eye for an eye. A tooth for a tooth. A head for a head and life for a
life. If this is the price of freedom, we won't hesitate to pay the price.
- Malcolm X, black activist, 1964 speech
From the passage, you can conclude that Malcolm X-
b
Agreed with the philosophy of nonviolence
Was a militant civil rights activist
Wanted to overthrow the government
Broke away from the Nation of Islam
d

Answers

Answer:

Was a militant civil rights activist

Explanation:

According to the given passage, Malcolm X is quoted to be saying that he believes in a fair exchange. An eye for an eye, a tooth for a tooth, a head for a head and a life for a life and if that was the price of freedom, he wouldn't hesitate to pay the price.

From this statements, it is immediately clear that Malcolm X is not an advocate of non-violence and is a militant civil rights activist.

Central claim: Animal testing is important because it provides valuable scientific breakthroughs. Which reason best supports the central claim? Animal testing is a practice that has been around since the time of ancient Greeks. Labs conducting test on animals must pass rigorous tests and be granted a license. Animal testing is cruel, and the animal that are tested endure great suffering, and even death. A number of lifesaving drugs and services procedure are the direct products of animal testing.

Answers

Answer: A number of lifesaving drugs and services procedure are the direct products of animal testing

Explanation:

The reason that beats support the central claim "Animal testing is important because it provides valuable scientific breakthroughs" is that a number of lifesaving drugs and services procedure are the direct products of animal testing.

This answer supports the claim as it shows that testing of animals is vital for breakthroughs in science. Other options are wrong as they don not support the claim.

Name the two main alliances of WW1 and the countries who belonged to each alliance.

Answers

Answer:

The Entente vs the Central powers (Britain, France, Russia, Belgium, Romania, later Italy and Greece vs Germany, Italy, Austro-Hungary, later Ottoman empire)

Explanation:

Italy was on both sides of the war because of promises of land by the entente or "the Allies" while it was originally on the side of the central powers previously by the alliance system that was going on about between the nations of Europe.

How might Frederick Douglas’s speech encourage African American men to join the U.S. Military? in 1863.

Answers

Answer:

Because the war was seen as a promise to true equality for African Americans  and people of color.

Explanation:

Describe the relationship the Jewish people had with the Romans.

Answers

Answer:

Jews in Rome

Julius Caesar and Augustus supported laws that allowed Jews protection to worship as they chose. Synagogues were classified as colleges to get around Roman laws banning secret societies and the temples were allowed to collect the yearly tax paid by all Jewish men for temple maintenance.

which aspect of the us congress most reflects the constitutional value of republicaism

Answers

Members of Congress often support political positions that mirror voter opinion in their home states. Explanation: The aspect of the U.S. Congress that most reflects the constitutional value of republicanism is members of Congress often support political positions that mirror voter opinion in their home states.
Answer: Members of Congress often support political positions that mirror voter opinion in their home states. Explanation: The aspect of the U.S. Congress that most reflects the constitutional value of republicanism is members of Congress often support political positions that mirror voter opinion in their home states.

What hardships do African Americans face?

Answers

American families with children (28 percent) experienced at least one of three hardships overcrowded housing, hunger or the risk of hunger (termed “food insecurity” ) by the ( government), or lack of needed medical care in the 12 months

Why did General Macarthur and President Truman disagree about how to fight the Korean War?

Answers

Answer:

They both disagreed on the decision of dropping the nuclear bomb in Northern Korea where Communism has been spread. General Macarthur was for the decision to drop the nuke while President Truman was against the decision of dropping the nuke. Truman was against it because he didn't want to risk nuclear, global, and environmental destruction.

Explanation:

According to Zinn, what created the subservient role of women in American society?

Answers

Answer:

According to Zinn, what created the subservient role of women in American society was the early colonial days. The days in which women were imported as sex slaves, childbearers, companions, and indentured servants. “They were to be obedient to masters and mistresses… They were poorly paid and often treated rudely and harshly, deprived of good food and privacy” (95). Due to this, women were intimately opressed as sex slaves, childbearers, companions, and indentured servants.

Explanation:

Mark as brainliest.

Melita Maschmann asks, "How could young people, in particular, fail to enjoy such a
life?” Why did living and working in the Warthegau appeal to Maschmann and other
young people?
Need help will give you Brainly if you give me a reasonable answer

Answers

Answer:

they believed that it would heal the wounds of their childhood and early youth.

Explanation:

Since very young age, Maschmann was indoctrinated about Germany’s defeat in the First World War and the hardships and humiliation her country faced after the war.

So when she grew up, she developed a sense of partriotism towards her country and believed that it was her duty to take all measures to reclaim her country's honor.

Similarly, many young people like her felt that living and working for "colonisation work” in “advanced posts” like Warthegau was an opportunity to give back to their country as well.

Therefore, the thought of living and working in the Warthegau seemed appealing to Maschmann and other young people because they believed that it would heal the wounds of their childhood and early youth.

HELP!!!

Why do you think the first row of Soviet soldiers were given rifles while the second were given ammunition?
Why do you think Hitler loved the city of Stalingrad so much?

Answers

Iririjtjrmkekejebrrhrrt

What was the result of the Mexican-American War?
United States took land from Mexico in the Treaty of Guadalupe-Hidalgo
United States becomes a vassal of Mexico
Free States expanded and ended slavery in the USA
United States, Mexico, and Canada agree to NAFTA

Answers

Answer: The war—in which U.S. forces were consistently victorious—resulted in the United States' acquisition of more than 500,000 square miles (1,300,000 square km) of Mexican territory extending westward from the Rio Grande to the Pacific Ocean.

Explanation:

6. A radio station that carries news, features, and editorial opinions about
your area is which type of public?
OA) financiar
O B) media
C) citizen-action
O D) local
O E) government​

Answers

Answer: O B) media

brainliest?

Explanation:

In his Inaugural Address, what reasoning does John F. Kennedy give for seeking peace with America's enemies?
Select all that apply.
The world's powerful weapons could destroy all of humanity.
The United States has lost too many soldiers in World Wars I and II.
The cost of modern weapons is becoming too expensive for nations to afford.
If nations work together, they can effectively fight humankind's common enemies.

Answers

Answer:

The world's powerful weapons could destroy all of humanity.

The cost of modern weapons is becoming too expensive for nations to afford.

If nations work together, they can effectively fight humankind's common enemies.

Explanation:

In his inaugural Address, John F. Kennedy give for seeking peace with America's enemies are the world's powerful weapons could destroy all of the humanity, cost of modern weapons is becoming too expensive for nations to afford and if nations work together, they can effectively fight humankind's common enemies.

What do you mean by inaugural address?

The inaugural address refers to a speech given in the ceremony that informs the people of their intentions as a leader.

In his inaugural Address, the John F. Kennedy give for seeking peace with America's enemies are that the world's powerful weapons could destroy all of humanity, the cost of modern weapons is becoming too expensive for nations to afford and if nations work together they can effectively fight human kind's common enemies.

Therefore, A, C and D are the correct options.

Learn more about America's enemies here:

https://brainly.com/question/2334180

#SPJ2

What was the goal of the Anaconda Plan? (1pt)

Answers

Answer:

The plan called for a naval blockade of the Confederate littoral, a thrust down the Mississippi, and the strangulation of the South by Union land and naval forces.

Explanation:

pls helpppppp!!!!!!!!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

a

b

d

c

Explanation:

Answer:

a

b

d

e

Explanation:

I need 5 Brainliest before I can become expert

Who invented the railway engine

Answers

Answer:

George Stephenson

George Stephenson, (born June 9, 1781, Wylam, Northumberland, England—died August 12, 1848, Chesterfield, Derbyshire), English engineer and principal inventor of the railroad locomotive.

Explanation:

Answer:

This is your answer

Who wrote the patriotic pamphlet, Novanglus?
Samuel Adams
B. John Adams
C. Abigail Adams
D. Phillis Wheatley
Need it ASAP!!!!!

Answers

john adams, Amsterdam 1782.

Other Questions
Diego bought some raisins and walnuts to make trailmix. Raisins cost $4 a pound and walnuts cost $8 apound. Diego spent $15 on both ingredients. Decide ifeach pair of values could be a combination of raisinsand walnuts that Diego bought.Explain your answer. HELPP!!!!!!!!!!!!!!!! What transformation is shown below?reflectioncan't be determinedrotationtranslation In triangle ABC, angle A measures 50.5 degrees and angle B measures 74 degrees. What is the measure of angle C? DO NOT TRY TO PUT A DEGREE SIGN. JUST TYPE THE ANSWER!! - 1:Translate the following sequence into a short protein. Add hyphens between,please.235'- AUG GCA AAA GAG GAA CAU UAA - 3'56Second LetterUAGPheTyrSerUUUUUUCUUAUUGUCUUCCUCAUCGUAUUACUAAUAG39LeuStopStopUGUCys UUGCUGA Stop AUGG Trp GCGUCGCArgCGAGHisProCUUC | CCCUACUGCCULeu CCCCCACCGCAUCACCAACAGGin121st3rdCGGletterAsnSerlleAUUA AUCAUAAUGACUACCACAThrAAUAACAAAAAGAGUAGCAGAAGGU letterAG15Lys|ArgMet ACGAspGUUGGUCGUAGUGValAlaGCUGCCGCAGCGGAUGACGAAGAGGGUGGCGGAGGGGly|Duco18Gluhttp://biology.kenyon.edu/courses/biol114/Chap05/Chapter05.html1 Kailynn has been on a roll, and solving 5 math problems every 2.5 minutes. At this rae, how many problem will she solve in 30 minutes. What is the slope of the line in the graph? please help me with this please, this is due in a couple of minutes. Which states the best reason why Chapter 15 might be titled "Nest-Building"?The robin is building a nest in the garden.A nest is a symbol for a safe place where Mary and Colin can grow.The robins are a symbol for new life returning to the garden.Mary and Dickon want Colin to watch the robin building the nest. You estimate that there are 40 marbles in a jar. The actual amount is48 marbles. Find the percent error. Round to the nearest tenth of a percent. help me plz which formula should I use?? What is the pear harbor and what happened 1. When did Texas become a territory of the United States? 5 oranges are bought for $4.00 and later sold at $0.10 each .find the loss percent. What is an advantage to being ectothermic?Question 18 options:Ectothermic animals require much less energy to survive than endothermic animals. Ectothermic animals can sleep longer than endothermic animals. Ectothermic animals always live longer than endothermic animals. Ectothermic animals can live in a greater number of environments than endothermic animals. Why is it important for the brain to be so well protected? Bryson is painting kitchen stools. Each stool requires 1 1/2 liters of paint. Bryson has 20 liters of paint, How many stool will he be able to paint? En France, on sert toujours une salade verte au dbut d'un repas.TrueFalseNEXT QUESTIONASV COR irin How are ionic compounds named? What is the volume of the square pyramid ?